Incidental Mutation 'R8067:Polr3c'
ID 620046
Institutional Source Beutler Lab
Gene Symbol Polr3c
Ensembl Gene ENSMUSG00000028099
Gene Name polymerase (RNA) III (DNA directed) polypeptide C
Synonyms 4933407E01Rik, RPC62, RPC3
MMRRC Submission 067502-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.960) question?
Stock # R8067 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 96618836-96634803 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 96622968 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 350 (E350G)
Ref Sequence ENSEMBL: ENSMUSP00000029741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029741] [ENSMUST00000154679]
AlphaFold Q9D483
Predicted Effect probably null
Transcript: ENSMUST00000029741
AA Change: E350G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029741
Gene: ENSMUSG00000028099
AA Change: E350G

DomainStartEndE-ValueType
Pfam:HTH_9 7 68 9.4e-26 PFAM
Pfam:RNA_pol_Rpc82 146 344 7.6e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128918
SMART Domains Protein: ENSMUSP00000119236
Gene: ENSMUSG00000028099

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpc82 20 180 5.9e-32 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000154679
AA Change: E350G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122435
Gene: ENSMUSG00000028099
AA Change: E350G

DomainStartEndE-ValueType
Pfam:HTH_9 7 68 1.6e-26 PFAM
Pfam:RNA_pol_Rpc82 146 344 7.6e-46 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik A T 8: 13,608,643 (GRCm39) D145E possibly damaging Het
Adcy7 T C 8: 89,037,697 (GRCm39) L255P probably damaging Het
Cbx7 A T 15: 79,818,099 (GRCm39) V1D unknown Het
Cd209c A C 8: 3,995,700 (GRCm39) M34R probably benign Het
Chodl A T 16: 78,743,601 (GRCm39) L229F probably damaging Het
Depdc5 C A 5: 33,053,252 (GRCm39) N197K possibly damaging Het
Dnai1 T A 4: 41,614,258 (GRCm39) D311E probably damaging Het
Dop1a A G 9: 86,400,392 (GRCm39) Y1017C probably benign Het
Dop1b T A 16: 93,562,336 (GRCm39) L927* probably null Het
Dpp10 A G 1: 123,280,389 (GRCm39) S646P probably benign Het
Ebf1 G A 11: 44,511,374 (GRCm39) V90M probably benign Het
Efhd1 C T 1: 87,192,313 (GRCm39) P48S probably benign Het
Fam83b T C 9: 76,398,380 (GRCm39) T908A probably benign Het
Fbxl16 G A 17: 26,036,957 (GRCm39) V313I probably damaging Het
Git2 C T 5: 114,904,579 (GRCm39) M113I probably damaging Het
Gpr87 T A 3: 59,087,308 (GRCm39) I66F probably damaging Het
H60c A C 10: 3,209,338 (GRCm39) L217V unknown Het
Iba57 T C 11: 59,054,086 (GRCm39) probably benign Het
Igkv11-125 C A 6: 67,890,814 (GRCm39) T44N probably benign Het
Itih2 T A 2: 10,128,294 (GRCm39) I136F probably damaging Het
Itpr3 T A 17: 27,329,836 (GRCm39) D1543E probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Mylk A T 16: 34,792,389 (GRCm39) E1570V probably benign Het
N4bp2 T A 5: 65,964,639 (GRCm39) L896H probably damaging Het
Ndc1 T A 4: 107,247,595 (GRCm39) S468T probably benign Het
Ndst3 T C 3: 123,395,094 (GRCm39) N512S probably damaging Het
Or51b6 A G 7: 103,555,610 (GRCm39) probably benign Het
Or5w15 T A 2: 87,568,147 (GRCm39) I174F probably damaging Het
Plekhn1 T C 4: 156,312,697 (GRCm39) I54V possibly damaging Het
Prpf8 T C 11: 75,390,976 (GRCm39) W1342R probably damaging Het
Pum1 T C 4: 130,478,836 (GRCm39) V486A possibly damaging Het
Rin2 T G 2: 145,702,977 (GRCm39) S558A probably damaging Het
Ripk4 A T 16: 97,564,737 (GRCm39) V58D probably damaging Het
Smyd3 A G 1: 179,238,028 (GRCm39) M113T possibly damaging Het
Spock1 A T 13: 57,843,984 (GRCm39) probably null Het
Srgap3 C T 6: 112,716,325 (GRCm39) R625H probably benign Het
Tasor2 C T 13: 3,619,602 (GRCm39) V2210I probably benign Het
Tmed2 T C 5: 124,684,986 (GRCm39) I134T possibly damaging Het
Washc2 T A 6: 116,201,464 (GRCm39) S353R probably damaging Het
Xdh T A 17: 74,207,652 (GRCm39) R902W probably benign Het
Zbtb5 A T 4: 44,994,972 (GRCm39) S137R probably benign Het
Zfp286 A T 11: 62,644,345 (GRCm39) I192K unknown Het
Zfp942 T C 17: 22,149,391 (GRCm39) Y38C probably damaging Het
Zfpm1 T C 8: 123,062,323 (GRCm39) S461P probably benign Het
Other mutations in Polr3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Polr3c APN 3 96,620,836 (GRCm39) missense probably damaging 1.00
IGL01904:Polr3c APN 3 96,623,981 (GRCm39) critical splice donor site probably null
IGL01964:Polr3c APN 3 96,619,291 (GRCm39) unclassified probably benign
IGL02640:Polr3c APN 3 96,624,002 (GRCm39) missense probably damaging 0.98
IGL02955:Polr3c APN 3 96,621,628 (GRCm39) missense probably damaging 1.00
IGL03129:Polr3c APN 3 96,626,770 (GRCm39) splice site probably benign
IGL03263:Polr3c APN 3 96,621,567 (GRCm39) splice site probably benign
R0503:Polr3c UTSW 3 96,620,952 (GRCm39) splice site probably null
R0800:Polr3c UTSW 3 96,626,627 (GRCm39) missense probably damaging 0.99
R0881:Polr3c UTSW 3 96,631,163 (GRCm39) missense probably damaging 0.99
R1763:Polr3c UTSW 3 96,620,911 (GRCm39) missense probably damaging 1.00
R1931:Polr3c UTSW 3 96,626,614 (GRCm39) missense probably damaging 1.00
R1932:Polr3c UTSW 3 96,626,614 (GRCm39) missense probably damaging 1.00
R1994:Polr3c UTSW 3 96,621,689 (GRCm39) splice site probably null
R3771:Polr3c UTSW 3 96,633,170 (GRCm39) missense probably damaging 1.00
R4116:Polr3c UTSW 3 96,622,560 (GRCm39) missense probably damaging 1.00
R4614:Polr3c UTSW 3 96,623,787 (GRCm39) missense probably benign 0.00
R4732:Polr3c UTSW 3 96,630,977 (GRCm39) missense probably damaging 1.00
R4733:Polr3c UTSW 3 96,630,977 (GRCm39) missense probably damaging 1.00
R5057:Polr3c UTSW 3 96,619,373 (GRCm39) missense probably damaging 0.98
R5058:Polr3c UTSW 3 96,630,833 (GRCm39) missense probably benign 0.01
R5756:Polr3c UTSW 3 96,621,450 (GRCm39) missense probably damaging 1.00
R6005:Polr3c UTSW 3 96,626,784 (GRCm39) missense possibly damaging 0.96
R6009:Polr3c UTSW 3 96,620,930 (GRCm39) missense probably damaging 1.00
R6580:Polr3c UTSW 3 96,634,659 (GRCm39) splice site probably null
R7003:Polr3c UTSW 3 96,630,954 (GRCm39) missense possibly damaging 0.94
R7475:Polr3c UTSW 3 96,622,501 (GRCm39) missense probably benign 0.11
R8065:Polr3c UTSW 3 96,622,968 (GRCm39) missense probably null 0.80
R8478:Polr3c UTSW 3 96,624,066 (GRCm39) splice site probably benign
R8729:Polr3c UTSW 3 96,634,796 (GRCm39) unclassified probably benign
R8865:Polr3c UTSW 3 96,622,517 (GRCm39) unclassified probably benign
R9532:Polr3c UTSW 3 96,629,866 (GRCm39) missense probably null
Predicted Primers PCR Primer
(F):5'- ACAGAGCTTTAGGGTGGCTG -3'
(R):5'- GCATTGCCACAGACAGGAAG -3'

Sequencing Primer
(F):5'- GCTGGTTAATTTGCCTAACTAGG -3'
(R):5'- ATGGTCAAAGTCAGTCTGGCTAC -3'
Posted On 2020-01-23