Incidental Mutation 'R8067:Ndst3'
ID620047
Institutional Source Beutler Lab
Gene Symbol Ndst3
Ensembl Gene ENSMUSG00000027977
Gene NameN-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Synonyms4930511P15Rik, 4921531K01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R8067 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location123526166-123690853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123601445 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 512 (N512S)
Ref Sequence ENSEMBL: ENSMUSP00000029602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029602] [ENSMUST00000124803] [ENSMUST00000132112] [ENSMUST00000137404] [ENSMUST00000154668] [ENSMUST00000172537]
Predicted Effect probably damaging
Transcript: ENSMUST00000029602
AA Change: N512S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029602
Gene: ENSMUSG00000027977
AA Change: N512S

DomainStartEndE-ValueType
Pfam:HSNSD 19 506 4.6e-272 PFAM
Pfam:Sulfotransfer_1 595 858 8.4e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124803
AA Change: N97S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122617
Gene: ENSMUSG00000027977
AA Change: N97S

DomainStartEndE-ValueType
Pfam:HSNSD 1 91 1.7e-62 PFAM
Pfam:Sulfotransfer_1 180 443 7.8e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132112
AA Change: N97S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120623
Gene: ENSMUSG00000027977
AA Change: N97S

DomainStartEndE-ValueType
Pfam:HSNSD 1 91 1.7e-62 PFAM
Pfam:Sulfotransfer_1 180 443 7.8e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000137404
AA Change: N512S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118796
Gene: ENSMUSG00000027977
AA Change: N512S

DomainStartEndE-ValueType
Pfam:HSNSD 19 506 6.4e-272 PFAM
PDB:1NST|A 549 637 2e-38 PDB
SCOP:d1nsta_ 570 641 9e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154668
AA Change: N512S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118207
Gene: ENSMUSG00000027977
AA Change: N512S

DomainStartEndE-ValueType
Pfam:HSNSD 20 506 1.7e-253 PFAM
Pfam:Sulfotransfer_1 595 858 8.4e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172537
AA Change: N512S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133657
Gene: ENSMUSG00000027977
AA Change: N512S

DomainStartEndE-ValueType
Pfam:HSNSD 20 328 2.4e-130 PFAM
Pfam:HSNSD 326 425 8.2e-62 PFAM
PDB:1NST|A 468 556 7e-39 PDB
SCOP:d1nsta_ 489 560 5e-17 SMART
Meta Mutation Damage Score 0.5322 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. This monomeric bifunctional enzyme catalyzes the N-deacetylation and N-sulfation of N-acetylglucosamine residues in heparan sulfate and heparin, which are the initial chemical modifications required for the biosynthesis of the functional oligosaccharide sequences that define the specific ligand binding activities of heparan sulfate and heparin. [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a knockout allele exhibit decreased anxiety-related behavior, cholesterol levels and CD8+ T cells due to moderate heparan-sulfate undersulfation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik A T 8: 13,558,643 D145E possibly damaging Het
Adcy7 T C 8: 88,311,069 L255P probably damaging Het
Cbx7 A T 15: 79,933,898 V1D unknown Het
Cd209c A C 8: 3,945,700 M34R probably benign Het
Chodl A T 16: 78,946,713 L229F probably damaging Het
Depdc5 C A 5: 32,895,908 N197K possibly damaging Het
Dnaic1 T A 4: 41,614,258 D311E probably damaging Het
Dopey1 A G 9: 86,518,339 Y1017C probably benign Het
Dopey2 T A 16: 93,765,448 L927* probably null Het
Dpp10 A G 1: 123,352,660 S646P probably benign Het
Ebf1 G A 11: 44,620,547 V90M probably benign Het
Efhd1 C T 1: 87,264,591 P48S probably benign Het
Fam208b C T 13: 3,569,602 V2210I probably benign Het
Fam83b T C 9: 76,491,098 T908A probably benign Het
Fbxl16 G A 17: 25,817,983 V313I probably damaging Het
Git2 C T 5: 114,766,518 M113I probably damaging Het
Gpr87 T A 3: 59,179,887 I66F probably damaging Het
H60c A C 10: 3,259,338 L217V unknown Het
Iba57 T C 11: 59,163,260 probably benign Het
Igkv11-125 C A 6: 67,913,830 T44N probably benign Het
Itih2 T A 2: 10,123,483 I136F probably damaging Het
Itpr3 T A 17: 27,110,862 D1543E probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk A T 16: 34,972,019 E1570V probably benign Het
N4bp2 T A 5: 65,807,296 L896H probably damaging Het
Ndc1 T A 4: 107,390,398 S468T probably benign Het
Olfr1138 T A 2: 87,737,803 I174F probably damaging Het
Olfr65 A G 7: 103,906,403 probably benign Het
Plekhn1 T C 4: 156,228,240 I54V possibly damaging Het
Polr3c T C 3: 96,715,652 E350G probably null Het
Prpf8 T C 11: 75,500,150 W1342R probably damaging Het
Pum1 T C 4: 130,751,525 V486A possibly damaging Het
Rin2 T G 2: 145,861,057 S558A probably damaging Het
Ripk4 A T 16: 97,763,537 V58D probably damaging Het
Smyd3 A G 1: 179,410,463 M113T possibly damaging Het
Spock1 A T 13: 57,696,171 probably null Het
Srgap3 C T 6: 112,739,364 R625H probably benign Het
Tmed2 T C 5: 124,546,923 I134T possibly damaging Het
Washc2 T A 6: 116,224,503 S353R probably damaging Het
Xdh T A 17: 73,900,657 R902W probably benign Het
Zbtb5 A T 4: 44,994,972 S137R probably benign Het
Zfp286 A T 11: 62,753,519 I192K unknown Het
Zfp942 T C 17: 21,930,410 Y38C probably damaging Het
Zfpm1 T C 8: 122,335,584 S461P probably benign Het
Other mutations in Ndst3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Ndst3 APN 3 123627950 splice site probably benign
IGL00543:Ndst3 APN 3 123672263 missense probably damaging 0.99
IGL01067:Ndst3 APN 3 123546817 missense probably damaging 1.00
IGL01301:Ndst3 APN 3 123548916 missense probably damaging 0.97
IGL01975:Ndst3 APN 3 123601514 missense possibly damaging 0.67
IGL02376:Ndst3 APN 3 123556798 missense probably damaging 0.98
IGL02715:Ndst3 APN 3 123546761 splice site probably benign
IGL03111:Ndst3 APN 3 123672096 missense possibly damaging 0.96
Jack_sprat UTSW 3 123552552 missense probably damaging 0.99
ANU18:Ndst3 UTSW 3 123548916 missense probably damaging 0.97
R0027:Ndst3 UTSW 3 123671513 missense probably damaging 1.00
R0288:Ndst3 UTSW 3 123672194 missense probably benign 0.03
R0630:Ndst3 UTSW 3 123562071 missense probably damaging 0.98
R1168:Ndst3 UTSW 3 123606968 missense probably benign 0.22
R1400:Ndst3 UTSW 3 123556828 missense probably damaging 1.00
R1513:Ndst3 UTSW 3 123601455 missense possibly damaging 0.75
R1524:Ndst3 UTSW 3 123548906 missense possibly damaging 0.94
R1830:Ndst3 UTSW 3 123548938 missense probably damaging 0.96
R1831:Ndst3 UTSW 3 123601478 missense probably benign
R1865:Ndst3 UTSW 3 123671471 missense probably damaging 1.00
R1871:Ndst3 UTSW 3 123562024 missense probably damaging 1.00
R2041:Ndst3 UTSW 3 123672215 missense probably benign 0.01
R2056:Ndst3 UTSW 3 123671885 missense probably damaging 0.98
R2362:Ndst3 UTSW 3 123552678 missense possibly damaging 0.94
R2484:Ndst3 UTSW 3 123552537 missense possibly damaging 0.83
R3747:Ndst3 UTSW 3 123671552 missense probably benign 0.09
R4152:Ndst3 UTSW 3 123672227 missense probably damaging 1.00
R4153:Ndst3 UTSW 3 123672227 missense probably damaging 1.00
R4154:Ndst3 UTSW 3 123672227 missense probably damaging 1.00
R4512:Ndst3 UTSW 3 123671666 missense probably damaging 1.00
R4579:Ndst3 UTSW 3 123546825 missense probably benign 0.00
R4611:Ndst3 UTSW 3 123671549 missense probably benign 0.35
R4646:Ndst3 UTSW 3 123672035 missense probably damaging 0.96
R4718:Ndst3 UTSW 3 123672266 missense probably benign 0.35
R4944:Ndst3 UTSW 3 123607027 missense probably damaging 0.99
R4945:Ndst3 UTSW 3 123552552 missense probably damaging 1.00
R5179:Ndst3 UTSW 3 123552532 missense probably damaging 0.97
R5232:Ndst3 UTSW 3 123672239 missense probably damaging 0.99
R5421:Ndst3 UTSW 3 123634359 splice site probably null
R5874:Ndst3 UTSW 3 123561907 missense probably damaging 1.00
R6030:Ndst3 UTSW 3 123552519 missense probably damaging 1.00
R6030:Ndst3 UTSW 3 123552519 missense probably damaging 1.00
R6228:Ndst3 UTSW 3 123671652 nonsense probably null
R6496:Ndst3 UTSW 3 123552552 missense probably damaging 0.99
R6562:Ndst3 UTSW 3 123552532 missense probably damaging 0.97
R7045:Ndst3 UTSW 3 123672083 missense probably damaging 0.96
R7152:Ndst3 UTSW 3 123552656 missense possibly damaging 0.66
R7202:Ndst3 UTSW 3 123671739 missense possibly damaging 0.94
R7239:Ndst3 UTSW 3 123606906 missense probably damaging 1.00
R7305:Ndst3 UTSW 3 123601482 missense possibly damaging 0.62
R7417:Ndst3 UTSW 3 123671664 missense probably damaging 1.00
R7469:Ndst3 UTSW 3 123671661 missense possibly damaging 0.82
R7553:Ndst3 UTSW 3 123557060 splice site probably null
R7955:Ndst3 UTSW 3 123606937 missense probably benign 0.01
R8065:Ndst3 UTSW 3 123601445 missense probably damaging 1.00
R8363:Ndst3 UTSW 3 123556868 missense possibly damaging 0.83
R8708:Ndst3 UTSW 3 123528915 missense probably benign 0.01
R8752:Ndst3 UTSW 3 123549035 missense probably damaging 1.00
R9051:Ndst3 UTSW 3 123671900 missense probably benign 0.00
Z1176:Ndst3 UTSW 3 123552630 missense probably damaging 1.00
Z1176:Ndst3 UTSW 3 123627969 missense possibly damaging 0.49
Z1176:Ndst3 UTSW 3 123671494 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTCCTATCTTTGTGCTTACAA -3'
(R):5'- TGCATGATGGAAACCAGAACT -3'

Sequencing Primer
(F):5'- CTTACAAAATCTGTGCTGAGTGAGG -3'
(R):5'- GGAAACCAGAACTTTCCCCTTACTTG -3'
Posted On2020-01-23