Incidental Mutation 'R8067:Dnai1'
ID 620048
Institutional Source Beutler Lab
Gene Symbol Dnai1
Ensembl Gene ENSMUSG00000061322
Gene Name dynein axonemal intermediate chain 1
Synonyms b2b1526Clo, Dnaic1, 1110066F04Rik
MMRRC Submission 067502-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.613) question?
Stock # R8067 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 41569775-41638158 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 41614258 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 311 (D311E)
Ref Sequence ENSEMBL: ENSMUSP00000100028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102963]
AlphaFold Q8C0M8
Predicted Effect probably damaging
Transcript: ENSMUST00000102963
AA Change: D311E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100028
Gene: ENSMUSG00000061322
AA Change: D311E

DomainStartEndE-ValueType
low complexity region 134 158 N/A INTRINSIC
low complexity region 238 261 N/A INTRINSIC
Blast:WD40 319 370 1e-17 BLAST
WD40 374 413 1.5e-3 SMART
WD40 419 465 4.4e-2 SMART
Blast:WD40 493 526 5e-13 BLAST
WD40 530 570 9.3e-9 SMART
WD40 575 612 6e-3 SMART
WD40 623 659 1.4e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dynein intermediate chain family. The encoded protein is part of the dynein complex in respiratory cilia. The inner- and outer-arm dyneins, which bridge between the doublet microtubules in axonemes, are the force-generating proteins responsible for the sliding movement in axonemes. The intermediate and light chains, thought to form the base of the dynein arm, help mediate attachment and may also participate in regulating dynein activity. Mutations in this gene result in abnormal ciliary ultrastructure and function associated with primary ciliary dyskinesia and Kartagener syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mutant mice exhibit situs inversus, heterotaxia and ciliary dyskinesia including cardiovascular defects and decreased ciliary activity in the trachea, reduced to absent mucociliary clearance, and chronic rhinosinusitis. Hydrocephaly is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik A T 8: 13,608,643 (GRCm39) D145E possibly damaging Het
Adcy7 T C 8: 89,037,697 (GRCm39) L255P probably damaging Het
Cbx7 A T 15: 79,818,099 (GRCm39) V1D unknown Het
Cd209c A C 8: 3,995,700 (GRCm39) M34R probably benign Het
Chodl A T 16: 78,743,601 (GRCm39) L229F probably damaging Het
Depdc5 C A 5: 33,053,252 (GRCm39) N197K possibly damaging Het
Dop1a A G 9: 86,400,392 (GRCm39) Y1017C probably benign Het
Dop1b T A 16: 93,562,336 (GRCm39) L927* probably null Het
Dpp10 A G 1: 123,280,389 (GRCm39) S646P probably benign Het
Ebf1 G A 11: 44,511,374 (GRCm39) V90M probably benign Het
Efhd1 C T 1: 87,192,313 (GRCm39) P48S probably benign Het
Fam83b T C 9: 76,398,380 (GRCm39) T908A probably benign Het
Fbxl16 G A 17: 26,036,957 (GRCm39) V313I probably damaging Het
Git2 C T 5: 114,904,579 (GRCm39) M113I probably damaging Het
Gpr87 T A 3: 59,087,308 (GRCm39) I66F probably damaging Het
H60c A C 10: 3,209,338 (GRCm39) L217V unknown Het
Iba57 T C 11: 59,054,086 (GRCm39) probably benign Het
Igkv11-125 C A 6: 67,890,814 (GRCm39) T44N probably benign Het
Itih2 T A 2: 10,128,294 (GRCm39) I136F probably damaging Het
Itpr3 T A 17: 27,329,836 (GRCm39) D1543E probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Mylk A T 16: 34,792,389 (GRCm39) E1570V probably benign Het
N4bp2 T A 5: 65,964,639 (GRCm39) L896H probably damaging Het
Ndc1 T A 4: 107,247,595 (GRCm39) S468T probably benign Het
Ndst3 T C 3: 123,395,094 (GRCm39) N512S probably damaging Het
Or51b6 A G 7: 103,555,610 (GRCm39) probably benign Het
Or5w15 T A 2: 87,568,147 (GRCm39) I174F probably damaging Het
Plekhn1 T C 4: 156,312,697 (GRCm39) I54V possibly damaging Het
Polr3c T C 3: 96,622,968 (GRCm39) E350G probably null Het
Prpf8 T C 11: 75,390,976 (GRCm39) W1342R probably damaging Het
Pum1 T C 4: 130,478,836 (GRCm39) V486A possibly damaging Het
Rin2 T G 2: 145,702,977 (GRCm39) S558A probably damaging Het
Ripk4 A T 16: 97,564,737 (GRCm39) V58D probably damaging Het
Smyd3 A G 1: 179,238,028 (GRCm39) M113T possibly damaging Het
Spock1 A T 13: 57,843,984 (GRCm39) probably null Het
Srgap3 C T 6: 112,716,325 (GRCm39) R625H probably benign Het
Tasor2 C T 13: 3,619,602 (GRCm39) V2210I probably benign Het
Tmed2 T C 5: 124,684,986 (GRCm39) I134T possibly damaging Het
Washc2 T A 6: 116,201,464 (GRCm39) S353R probably damaging Het
Xdh T A 17: 74,207,652 (GRCm39) R902W probably benign Het
Zbtb5 A T 4: 44,994,972 (GRCm39) S137R probably benign Het
Zfp286 A T 11: 62,644,345 (GRCm39) I192K unknown Het
Zfp942 T C 17: 22,149,391 (GRCm39) Y38C probably damaging Het
Zfpm1 T C 8: 123,062,323 (GRCm39) S461P probably benign Het
Other mutations in Dnai1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02678:Dnai1 APN 4 41,602,917 (GRCm39) missense probably benign 0.03
IGL02825:Dnai1 APN 4 41,625,101 (GRCm39) splice site probably benign
IGL03072:Dnai1 APN 4 41,602,979 (GRCm39) missense probably benign 0.00
H8562:Dnai1 UTSW 4 41,629,833 (GRCm39) missense possibly damaging 0.81
R0114:Dnai1 UTSW 4 41,605,686 (GRCm39) splice site probably benign
R0138:Dnai1 UTSW 4 41,629,814 (GRCm39) missense possibly damaging 0.49
R0153:Dnai1 UTSW 4 41,635,162 (GRCm39) unclassified probably benign
R0465:Dnai1 UTSW 4 41,629,988 (GRCm39) splice site probably null
R0550:Dnai1 UTSW 4 41,596,274 (GRCm39) nonsense probably null
R0555:Dnai1 UTSW 4 41,625,335 (GRCm39) missense possibly damaging 0.64
R0890:Dnai1 UTSW 4 41,604,253 (GRCm39) missense possibly damaging 0.69
R0928:Dnai1 UTSW 4 41,602,566 (GRCm39) missense possibly damaging 0.57
R0944:Dnai1 UTSW 4 41,629,997 (GRCm39) missense probably benign
R1714:Dnai1 UTSW 4 41,632,164 (GRCm39) missense probably benign 0.12
R1902:Dnai1 UTSW 4 41,625,319 (GRCm39) nonsense probably null
R1919:Dnai1 UTSW 4 41,570,020 (GRCm39) critical splice donor site probably null
R1983:Dnai1 UTSW 4 41,603,232 (GRCm39) missense probably benign
R2036:Dnai1 UTSW 4 41,632,225 (GRCm39) missense probably damaging 1.00
R2306:Dnai1 UTSW 4 41,625,239 (GRCm39) missense probably benign
R2925:Dnai1 UTSW 4 41,597,919 (GRCm39) missense probably damaging 1.00
R3404:Dnai1 UTSW 4 41,603,246 (GRCm39) missense probably benign 0.00
R3720:Dnai1 UTSW 4 41,602,615 (GRCm39) missense probably damaging 1.00
R3721:Dnai1 UTSW 4 41,602,615 (GRCm39) missense probably damaging 1.00
R3722:Dnai1 UTSW 4 41,602,615 (GRCm39) missense probably damaging 1.00
R3931:Dnai1 UTSW 4 41,604,229 (GRCm39) missense probably damaging 1.00
R4330:Dnai1 UTSW 4 41,637,966 (GRCm39) missense probably damaging 1.00
R4755:Dnai1 UTSW 4 41,610,269 (GRCm39) missense probably damaging 0.99
R4905:Dnai1 UTSW 4 41,614,269 (GRCm39) missense probably benign 0.05
R4997:Dnai1 UTSW 4 41,597,919 (GRCm39) missense possibly damaging 0.80
R5088:Dnai1 UTSW 4 41,632,251 (GRCm39) missense probably benign 0.02
R5088:Dnai1 UTSW 4 41,597,630 (GRCm39) missense probably benign 0.00
R5970:Dnai1 UTSW 4 41,625,281 (GRCm39) missense probably benign 0.14
R5987:Dnai1 UTSW 4 41,632,391 (GRCm39) missense probably benign 0.03
R6247:Dnai1 UTSW 4 41,605,775 (GRCm39) missense probably benign
R6727:Dnai1 UTSW 4 41,625,308 (GRCm39) missense probably benign
R6874:Dnai1 UTSW 4 41,632,412 (GRCm39) missense probably damaging 1.00
R6914:Dnai1 UTSW 4 41,625,176 (GRCm39) missense probably benign 0.01
R7508:Dnai1 UTSW 4 41,614,323 (GRCm39) missense probably benign 0.01
R7831:Dnai1 UTSW 4 41,614,695 (GRCm39) critical splice donor site probably null
R7832:Dnai1 UTSW 4 41,605,823 (GRCm39) missense probably benign 0.42
R7985:Dnai1 UTSW 4 41,630,055 (GRCm39) missense probably benign
R8065:Dnai1 UTSW 4 41,614,258 (GRCm39) missense probably damaging 1.00
R8234:Dnai1 UTSW 4 41,625,221 (GRCm39) missense probably benign 0.00
R8906:Dnai1 UTSW 4 41,625,125 (GRCm39) missense probably benign 0.00
R9537:Dnai1 UTSW 4 41,629,790 (GRCm39) critical splice acceptor site probably null
R9723:Dnai1 UTSW 4 41,603,302 (GRCm39) missense possibly damaging 0.95
X0065:Dnai1 UTSW 4 41,629,868 (GRCm39) missense possibly damaging 0.89
Z1176:Dnai1 UTSW 4 41,614,323 (GRCm39) missense probably benign 0.32
Z1177:Dnai1 UTSW 4 41,569,809 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGCTTTACTGTAGGCCCTGC -3'
(R):5'- TGGAAGAAGAGTCTTGTGGCTC -3'

Sequencing Primer
(F):5'- TAAACTCAACCTGTAGTCTCACAGTG -3'
(R):5'- TCAAGATTTGGCACGCAGC -3'
Posted On 2020-01-23