Incidental Mutation 'R8067:Ndc1'
ID 620050
Institutional Source Beutler Lab
Gene Symbol Ndc1
Ensembl Gene ENSMUSG00000028614
Gene Name NDC1 transmembrane nucleoporin
Synonyms sks, 2810475A17Rik, Tmem48
MMRRC Submission 067502-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.947) question?
Stock # R8067 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 107225244-107273543 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 107247595 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 468 (S468T)
Ref Sequence ENSEMBL: ENSMUSP00000120365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030357] [ENSMUST00000125342] [ENSMUST00000139560] [ENSMUST00000149366]
AlphaFold Q8VCB1
Predicted Effect probably benign
Transcript: ENSMUST00000030357
Predicted Effect probably benign
Transcript: ENSMUST00000125342
Predicted Effect probably benign
Transcript: ENSMUST00000139560
AA Change: S468T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000120365
Gene: ENSMUSG00000028614
AA Change: S468T

DomainStartEndE-ValueType
Pfam:Ndc1_Nup 20 666 1.7e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149366
AA Change: S468T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000137180
Gene: ENSMUSG00000028614
AA Change: S468T

DomainStartEndE-ValueType
Pfam:Ndc1_Nup 19 511 3.7e-136 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
MGI Phenotype PHENOTYPE: Mutations in this gene produce background sensitive growth rates and skeletal anomalies. Both females and males are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik A T 8: 13,608,643 (GRCm39) D145E possibly damaging Het
Adcy7 T C 8: 89,037,697 (GRCm39) L255P probably damaging Het
Cbx7 A T 15: 79,818,099 (GRCm39) V1D unknown Het
Cd209c A C 8: 3,995,700 (GRCm39) M34R probably benign Het
Chodl A T 16: 78,743,601 (GRCm39) L229F probably damaging Het
Depdc5 C A 5: 33,053,252 (GRCm39) N197K possibly damaging Het
Dnai1 T A 4: 41,614,258 (GRCm39) D311E probably damaging Het
Dop1a A G 9: 86,400,392 (GRCm39) Y1017C probably benign Het
Dop1b T A 16: 93,562,336 (GRCm39) L927* probably null Het
Dpp10 A G 1: 123,280,389 (GRCm39) S646P probably benign Het
Ebf1 G A 11: 44,511,374 (GRCm39) V90M probably benign Het
Efhd1 C T 1: 87,192,313 (GRCm39) P48S probably benign Het
Fam83b T C 9: 76,398,380 (GRCm39) T908A probably benign Het
Fbxl16 G A 17: 26,036,957 (GRCm39) V313I probably damaging Het
Git2 C T 5: 114,904,579 (GRCm39) M113I probably damaging Het
Gpr87 T A 3: 59,087,308 (GRCm39) I66F probably damaging Het
H60c A C 10: 3,209,338 (GRCm39) L217V unknown Het
Iba57 T C 11: 59,054,086 (GRCm39) probably benign Het
Igkv11-125 C A 6: 67,890,814 (GRCm39) T44N probably benign Het
Itih2 T A 2: 10,128,294 (GRCm39) I136F probably damaging Het
Itpr3 T A 17: 27,329,836 (GRCm39) D1543E probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Mylk A T 16: 34,792,389 (GRCm39) E1570V probably benign Het
N4bp2 T A 5: 65,964,639 (GRCm39) L896H probably damaging Het
Ndst3 T C 3: 123,395,094 (GRCm39) N512S probably damaging Het
Or51b6 A G 7: 103,555,610 (GRCm39) probably benign Het
Or5w15 T A 2: 87,568,147 (GRCm39) I174F probably damaging Het
Plekhn1 T C 4: 156,312,697 (GRCm39) I54V possibly damaging Het
Polr3c T C 3: 96,622,968 (GRCm39) E350G probably null Het
Prpf8 T C 11: 75,390,976 (GRCm39) W1342R probably damaging Het
Pum1 T C 4: 130,478,836 (GRCm39) V486A possibly damaging Het
Rin2 T G 2: 145,702,977 (GRCm39) S558A probably damaging Het
Ripk4 A T 16: 97,564,737 (GRCm39) V58D probably damaging Het
Smyd3 A G 1: 179,238,028 (GRCm39) M113T possibly damaging Het
Spock1 A T 13: 57,843,984 (GRCm39) probably null Het
Srgap3 C T 6: 112,716,325 (GRCm39) R625H probably benign Het
Tasor2 C T 13: 3,619,602 (GRCm39) V2210I probably benign Het
Tmed2 T C 5: 124,684,986 (GRCm39) I134T possibly damaging Het
Washc2 T A 6: 116,201,464 (GRCm39) S353R probably damaging Het
Xdh T A 17: 74,207,652 (GRCm39) R902W probably benign Het
Zbtb5 A T 4: 44,994,972 (GRCm39) S137R probably benign Het
Zfp286 A T 11: 62,644,345 (GRCm39) I192K unknown Het
Zfp942 T C 17: 22,149,391 (GRCm39) Y38C probably damaging Het
Zfpm1 T C 8: 123,062,323 (GRCm39) S461P probably benign Het
Other mutations in Ndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Ndc1 APN 4 107,241,977 (GRCm39) splice site probably benign
IGL00929:Ndc1 APN 4 107,246,694 (GRCm39) missense probably benign 0.23
IGL01340:Ndc1 APN 4 107,231,344 (GRCm39) missense probably damaging 1.00
IGL01376:Ndc1 APN 4 107,232,394 (GRCm39) missense probably damaging 1.00
IGL01954:Ndc1 APN 4 107,253,001 (GRCm39) missense probably damaging 1.00
IGL02290:Ndc1 APN 4 107,252,192 (GRCm39) splice site probably benign
IGL03251:Ndc1 APN 4 107,237,856 (GRCm39) missense possibly damaging 0.50
R1168:Ndc1 UTSW 4 107,253,009 (GRCm39) missense probably benign 0.02
R1541:Ndc1 UTSW 4 107,228,485 (GRCm39) nonsense probably null
R1605:Ndc1 UTSW 4 107,225,293 (GRCm39) missense probably damaging 0.96
R1612:Ndc1 UTSW 4 107,252,265 (GRCm39) splice site probably benign
R1716:Ndc1 UTSW 4 107,241,992 (GRCm39) missense probably damaging 1.00
R3522:Ndc1 UTSW 4 107,250,355 (GRCm39) missense probably damaging 0.99
R4036:Ndc1 UTSW 4 107,268,269 (GRCm39) missense probably benign 0.22
R4698:Ndc1 UTSW 4 107,268,334 (GRCm39) missense probably benign 0.06
R4794:Ndc1 UTSW 4 107,247,419 (GRCm39) missense probably benign 0.03
R5053:Ndc1 UTSW 4 107,231,415 (GRCm39) missense probably damaging 1.00
R5097:Ndc1 UTSW 4 107,231,358 (GRCm39) missense probably benign 0.01
R5158:Ndc1 UTSW 4 107,232,362 (GRCm39) missense probably damaging 1.00
R5217:Ndc1 UTSW 4 107,246,773 (GRCm39) missense probably benign
R5579:Ndc1 UTSW 4 107,237,901 (GRCm39) missense possibly damaging 0.74
R5666:Ndc1 UTSW 4 107,246,723 (GRCm39) missense possibly damaging 0.52
R5855:Ndc1 UTSW 4 107,240,904 (GRCm39) missense probably damaging 1.00
R6180:Ndc1 UTSW 4 107,268,395 (GRCm39) missense possibly damaging 0.65
R6525:Ndc1 UTSW 4 107,225,304 (GRCm39) missense probably benign 0.01
R8065:Ndc1 UTSW 4 107,247,595 (GRCm39) missense probably benign 0.01
R8100:Ndc1 UTSW 4 107,240,802 (GRCm39) missense possibly damaging 0.94
R8428:Ndc1 UTSW 4 107,226,017 (GRCm39) missense probably benign 0.00
R8952:Ndc1 UTSW 4 107,247,623 (GRCm39) missense probably benign 0.00
R8953:Ndc1 UTSW 4 107,238,890 (GRCm39) missense probably damaging 1.00
R9489:Ndc1 UTSW 4 107,247,863 (GRCm39) critical splice donor site probably null
R9606:Ndc1 UTSW 4 107,246,686 (GRCm39) missense probably damaging 0.97
Z1176:Ndc1 UTSW 4 107,243,799 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGGGCCAAGCTTTCTTATCAC -3'
(R):5'- TGGGTTAGAAATTGCAGACACTTG -3'

Sequencing Primer
(F):5'- CCACTGCATATGCTCTGTTACAGAAG -3'
(R):5'- GCAGACACTTGTTGATCTAGAAAAG -3'
Posted On 2020-01-23