Incidental Mutation 'R8067:Ndc1'
ID620050
Institutional Source Beutler Lab
Gene Symbol Ndc1
Ensembl Gene ENSMUSG00000028614
Gene NameNDC1 transmembrane nucleoporin
Synonymssks, Tmem48, 2810475A17Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R8067 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location107367784-107416346 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107390398 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 468 (S468T)
Ref Sequence ENSEMBL: ENSMUSP00000120365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030357] [ENSMUST00000125342] [ENSMUST00000139560] [ENSMUST00000149366]
Predicted Effect probably benign
Transcript: ENSMUST00000030357
Predicted Effect probably benign
Transcript: ENSMUST00000125342
Predicted Effect probably benign
Transcript: ENSMUST00000139560
AA Change: S468T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000120365
Gene: ENSMUSG00000028614
AA Change: S468T

DomainStartEndE-ValueType
Pfam:Ndc1_Nup 20 666 1.7e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149366
AA Change: S468T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000137180
Gene: ENSMUSG00000028614
AA Change: S468T

DomainStartEndE-ValueType
Pfam:Ndc1_Nup 19 511 3.7e-136 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutations in this gene produce background sensitive growth rates and skeletal anomalies. Both females and males are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik A T 8: 13,558,643 D145E possibly damaging Het
Adcy7 T C 8: 88,311,069 L255P probably damaging Het
Cbx7 A T 15: 79,933,898 V1D unknown Het
Cd209c A C 8: 3,945,700 M34R probably benign Het
Chodl A T 16: 78,946,713 L229F probably damaging Het
Depdc5 C A 5: 32,895,908 N197K possibly damaging Het
Dnaic1 T A 4: 41,614,258 D311E probably damaging Het
Dopey1 A G 9: 86,518,339 Y1017C probably benign Het
Dopey2 T A 16: 93,765,448 L927* probably null Het
Dpp10 A G 1: 123,352,660 S646P probably benign Het
Ebf1 G A 11: 44,620,547 V90M probably benign Het
Efhd1 C T 1: 87,264,591 P48S probably benign Het
Fam208b C T 13: 3,569,602 V2210I probably benign Het
Fam83b T C 9: 76,491,098 T908A probably benign Het
Fbxl16 G A 17: 25,817,983 V313I probably damaging Het
Git2 C T 5: 114,766,518 M113I probably damaging Het
Gpr87 T A 3: 59,179,887 I66F probably damaging Het
H60c A C 10: 3,259,338 L217V unknown Het
Igkv11-125 C A 6: 67,913,830 T44N probably benign Het
Itih2 T A 2: 10,123,483 I136F probably damaging Het
Itpr3 T A 17: 27,110,862 D1543E probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk A T 16: 34,972,019 E1570V probably benign Het
N4bp2 T A 5: 65,807,296 L896H probably damaging Het
Ndst3 T C 3: 123,601,445 N512S probably damaging Het
Olfr1138 T A 2: 87,737,803 I174F probably damaging Het
Olfr65 A G 7: 103,906,403 probably benign Het
Plekhn1 T C 4: 156,228,240 I54V possibly damaging Het
Polr3c T C 3: 96,715,652 E350G probably null Het
Prpf8 T C 11: 75,500,150 W1342R probably damaging Het
Pum1 T C 4: 130,751,525 V486A possibly damaging Het
Rin2 T G 2: 145,861,057 S558A probably damaging Het
Ripk4 A T 16: 97,763,537 V58D probably damaging Het
Smyd3 A G 1: 179,410,463 M113T possibly damaging Het
Srgap3 C T 6: 112,739,364 R625H probably benign Het
Tmed2 T C 5: 124,546,923 I134T possibly damaging Het
Washc2 T A 6: 116,224,503 S353R probably damaging Het
Xdh T A 17: 73,900,657 R902W probably benign Het
Zbtb5 A T 4: 44,994,972 S137R probably benign Het
Zfp286 A T 11: 62,753,519 I192K unknown Het
Zfp942 T C 17: 21,930,410 Y38C probably damaging Het
Zfpm1 T C 8: 122,335,584 S461P probably benign Het
Other mutations in Ndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Ndc1 APN 4 107384780 splice site probably benign
IGL00929:Ndc1 APN 4 107389497 missense probably benign 0.23
IGL01340:Ndc1 APN 4 107374147 missense probably damaging 1.00
IGL01376:Ndc1 APN 4 107375197 missense probably damaging 1.00
IGL01954:Ndc1 APN 4 107395804 missense probably damaging 1.00
IGL02290:Ndc1 APN 4 107394995 splice site probably benign
IGL03251:Ndc1 APN 4 107380659 missense possibly damaging 0.50
R1168:Ndc1 UTSW 4 107395812 missense probably benign 0.02
R1541:Ndc1 UTSW 4 107371288 nonsense probably null
R1605:Ndc1 UTSW 4 107368096 missense probably damaging 0.96
R1612:Ndc1 UTSW 4 107395068 splice site probably benign
R1716:Ndc1 UTSW 4 107384795 missense probably damaging 1.00
R3522:Ndc1 UTSW 4 107393158 missense probably damaging 0.99
R4036:Ndc1 UTSW 4 107411072 missense probably benign 0.22
R4698:Ndc1 UTSW 4 107411137 missense probably benign 0.06
R4794:Ndc1 UTSW 4 107390222 missense probably benign 0.03
R5053:Ndc1 UTSW 4 107374218 missense probably damaging 1.00
R5097:Ndc1 UTSW 4 107374161 missense probably benign 0.01
R5158:Ndc1 UTSW 4 107375165 missense probably damaging 1.00
R5217:Ndc1 UTSW 4 107389576 missense probably benign
R5579:Ndc1 UTSW 4 107380704 missense possibly damaging 0.74
R5666:Ndc1 UTSW 4 107389526 missense possibly damaging 0.52
R5855:Ndc1 UTSW 4 107383707 missense probably damaging 1.00
R6180:Ndc1 UTSW 4 107411198 missense possibly damaging 0.65
R6525:Ndc1 UTSW 4 107368107 missense probably benign 0.01
R8065:Ndc1 UTSW 4 107390398 missense probably benign 0.01
R8100:Ndc1 UTSW 4 107383605 missense possibly damaging 0.94
Z1176:Ndc1 UTSW 4 107386602 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGGGCCAAGCTTTCTTATCAC -3'
(R):5'- TGGGTTAGAAATTGCAGACACTTG -3'

Sequencing Primer
(F):5'- CCACTGCATATGCTCTGTTACAGAAG -3'
(R):5'- GCAGACACTTGTTGATCTAGAAAAG -3'
Posted On2020-01-23