Incidental Mutation 'R8067:Pum1'
ID 620051
Institutional Source Beutler Lab
Gene Symbol Pum1
Ensembl Gene ENSMUSG00000028580
Gene Name pumilio RNA-binding family member 1
Synonyms Pumm
MMRRC Submission 067502-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.890) question?
Stock # R8067 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 130390632-130508875 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 130478836 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 486 (V486A)
Ref Sequence ENSEMBL: ENSMUSP00000101613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030315] [ENSMUST00000097862] [ENSMUST00000097864] [ENSMUST00000105991] [ENSMUST00000105992] [ENSMUST00000143277]
AlphaFold Q80U78
Predicted Effect possibly damaging
Transcript: ENSMUST00000030315
AA Change: V583A

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000030315
Gene: ENSMUSG00000028580
AA Change: V583A

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 393 414 N/A INTRINSIC
low complexity region 443 458 N/A INTRINSIC
low complexity region 476 503 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 584 615 N/A INTRINSIC
low complexity region 627 637 N/A INTRINSIC
low complexity region 643 666 N/A INTRINSIC
low complexity region 672 696 N/A INTRINSIC
low complexity region 731 741 N/A INTRINSIC
low complexity region 763 783 N/A INTRINSIC
low complexity region 798 816 N/A INTRINSIC
Pumilio 849 884 1.75e-6 SMART
Pumilio 885 920 4.03e-6 SMART
Pumilio 921 955 5.24e-5 SMART
Pumilio 959 994 3.37e-8 SMART
Pumilio 995 1030 6.29e-8 SMART
Pumilio 1031 1066 1.04e-8 SMART
Pumilio 1067 1102 6.2e-7 SMART
Pumilio 1110 1145 8.77e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083262
Predicted Effect possibly damaging
Transcript: ENSMUST00000097862
AA Change: V582A

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095474
Gene: ENSMUSG00000028580
AA Change: V582A

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 393 414 N/A INTRINSIC
low complexity region 442 457 N/A INTRINSIC
low complexity region 475 502 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 583 614 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 642 665 N/A INTRINSIC
low complexity region 671 695 N/A INTRINSIC
low complexity region 730 740 N/A INTRINSIC
low complexity region 762 782 N/A INTRINSIC
low complexity region 797 815 N/A INTRINSIC
Pumilio 848 883 1.75e-6 SMART
Pumilio 884 919 4.03e-6 SMART
Pumilio 920 954 5.24e-5 SMART
Pumilio 958 993 3.37e-8 SMART
Pumilio 994 1029 6.29e-8 SMART
Pumilio 1030 1065 1.04e-8 SMART
Pumilio 1066 1101 6.2e-7 SMART
Pumilio 1109 1144 8.77e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000097864
AA Change: V582A

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095476
Gene: ENSMUSG00000028580
AA Change: V582A

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 393 414 N/A INTRINSIC
low complexity region 442 457 N/A INTRINSIC
low complexity region 475 502 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 583 614 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 642 665 N/A INTRINSIC
low complexity region 671 695 N/A INTRINSIC
low complexity region 730 740 N/A INTRINSIC
low complexity region 762 782 N/A INTRINSIC
low complexity region 797 815 N/A INTRINSIC
Pumilio 848 883 1.75e-6 SMART
Pumilio 884 919 4.03e-6 SMART
Pumilio 920 955 5.48e-8 SMART
Pumilio 956 991 3.37e-8 SMART
Pumilio 992 1027 6.29e-8 SMART
Pumilio 1028 1063 1.04e-8 SMART
Pumilio 1064 1099 6.2e-7 SMART
Pumilio 1107 1142 8.77e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105991
AA Change: V340A

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101612
Gene: ENSMUSG00000028580
AA Change: V340A

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 151 172 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 233 260 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
low complexity region 341 372 N/A INTRINSIC
low complexity region 384 394 N/A INTRINSIC
low complexity region 400 423 N/A INTRINSIC
low complexity region 429 453 N/A INTRINSIC
low complexity region 488 498 N/A INTRINSIC
low complexity region 520 540 N/A INTRINSIC
low complexity region 555 573 N/A INTRINSIC
Pumilio 606 641 1.75e-6 SMART
Pumilio 642 677 4.03e-6 SMART
Pumilio 678 713 5.48e-8 SMART
Pumilio 714 749 3.37e-8 SMART
Pumilio 750 785 6.29e-8 SMART
Pumilio 786 821 1.04e-8 SMART
Pumilio 822 857 6.2e-7 SMART
Pumilio 865 900 8.77e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105992
AA Change: V486A

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101613
Gene: ENSMUSG00000028580
AA Change: V486A

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 297 318 N/A INTRINSIC
low complexity region 346 361 N/A INTRINSIC
low complexity region 379 406 N/A INTRINSIC
low complexity region 431 442 N/A INTRINSIC
low complexity region 487 518 N/A INTRINSIC
low complexity region 530 540 N/A INTRINSIC
low complexity region 546 569 N/A INTRINSIC
low complexity region 575 599 N/A INTRINSIC
low complexity region 634 644 N/A INTRINSIC
low complexity region 666 686 N/A INTRINSIC
low complexity region 701 719 N/A INTRINSIC
Pumilio 752 787 1.75e-6 SMART
Pumilio 788 823 4.03e-6 SMART
Pumilio 824 858 5.24e-5 SMART
Pumilio 862 897 3.37e-8 SMART
Pumilio 898 933 6.29e-8 SMART
Pumilio 934 969 1.04e-8 SMART
Pumilio 970 1005 6.2e-7 SMART
Pumilio 1013 1048 8.77e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143277
SMART Domains Protein: ENSMUSP00000114629
Gene: ENSMUSG00000028580

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 151 172 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
Meta Mutation Damage Score 0.1272 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PUF family, evolutionarily conserved RNA-binding proteins related to the Pumilio proteins of Drosophila and the fem-3 mRNA binding factor proteins of C. elegans. The encoded protein contains a sequence-specific RNA binding domain comprised of eight repeats and N- and C-terminal flanking regions, and serves as a translational regulator of specific mRNAs by binding to their 3' untranslated regions. The evolutionarily conserved function of the encoded protein in invertebrates and lower vertebrates suggests that the human protein may be involved in translational regulation of embryogenesis, and cell development and differentiation. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased testes weight and size, decreased body weight, oligozoospermia, reduced male fertility, increased male germ cell apoptosis and small seminiferous tubules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik A T 8: 13,608,643 (GRCm39) D145E possibly damaging Het
Adcy7 T C 8: 89,037,697 (GRCm39) L255P probably damaging Het
Cbx7 A T 15: 79,818,099 (GRCm39) V1D unknown Het
Cd209c A C 8: 3,995,700 (GRCm39) M34R probably benign Het
Chodl A T 16: 78,743,601 (GRCm39) L229F probably damaging Het
Depdc5 C A 5: 33,053,252 (GRCm39) N197K possibly damaging Het
Dnai1 T A 4: 41,614,258 (GRCm39) D311E probably damaging Het
Dop1a A G 9: 86,400,392 (GRCm39) Y1017C probably benign Het
Dop1b T A 16: 93,562,336 (GRCm39) L927* probably null Het
Dpp10 A G 1: 123,280,389 (GRCm39) S646P probably benign Het
Ebf1 G A 11: 44,511,374 (GRCm39) V90M probably benign Het
Efhd1 C T 1: 87,192,313 (GRCm39) P48S probably benign Het
Fam83b T C 9: 76,398,380 (GRCm39) T908A probably benign Het
Fbxl16 G A 17: 26,036,957 (GRCm39) V313I probably damaging Het
Git2 C T 5: 114,904,579 (GRCm39) M113I probably damaging Het
Gpr87 T A 3: 59,087,308 (GRCm39) I66F probably damaging Het
H60c A C 10: 3,209,338 (GRCm39) L217V unknown Het
Iba57 T C 11: 59,054,086 (GRCm39) probably benign Het
Igkv11-125 C A 6: 67,890,814 (GRCm39) T44N probably benign Het
Itih2 T A 2: 10,128,294 (GRCm39) I136F probably damaging Het
Itpr3 T A 17: 27,329,836 (GRCm39) D1543E probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Mylk A T 16: 34,792,389 (GRCm39) E1570V probably benign Het
N4bp2 T A 5: 65,964,639 (GRCm39) L896H probably damaging Het
Ndc1 T A 4: 107,247,595 (GRCm39) S468T probably benign Het
Ndst3 T C 3: 123,395,094 (GRCm39) N512S probably damaging Het
Or51b6 A G 7: 103,555,610 (GRCm39) probably benign Het
Or5w15 T A 2: 87,568,147 (GRCm39) I174F probably damaging Het
Plekhn1 T C 4: 156,312,697 (GRCm39) I54V possibly damaging Het
Polr3c T C 3: 96,622,968 (GRCm39) E350G probably null Het
Prpf8 T C 11: 75,390,976 (GRCm39) W1342R probably damaging Het
Rin2 T G 2: 145,702,977 (GRCm39) S558A probably damaging Het
Ripk4 A T 16: 97,564,737 (GRCm39) V58D probably damaging Het
Smyd3 A G 1: 179,238,028 (GRCm39) M113T possibly damaging Het
Spock1 A T 13: 57,843,984 (GRCm39) probably null Het
Srgap3 C T 6: 112,716,325 (GRCm39) R625H probably benign Het
Tasor2 C T 13: 3,619,602 (GRCm39) V2210I probably benign Het
Tmed2 T C 5: 124,684,986 (GRCm39) I134T possibly damaging Het
Washc2 T A 6: 116,201,464 (GRCm39) S353R probably damaging Het
Xdh T A 17: 74,207,652 (GRCm39) R902W probably benign Het
Zbtb5 A T 4: 44,994,972 (GRCm39) S137R probably benign Het
Zfp286 A T 11: 62,644,345 (GRCm39) I192K unknown Het
Zfp942 T C 17: 22,149,391 (GRCm39) Y38C probably damaging Het
Zfpm1 T C 8: 123,062,323 (GRCm39) S461P probably benign Het
Other mutations in Pum1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Pum1 APN 4 130,471,100 (GRCm39) missense probably damaging 1.00
IGL01327:Pum1 APN 4 130,457,854 (GRCm39) missense probably damaging 0.97
IGL01360:Pum1 APN 4 130,455,481 (GRCm39) intron probably benign
IGL02055:Pum1 APN 4 130,481,365 (GRCm39) missense probably benign 0.19
IGL02713:Pum1 APN 4 130,493,323 (GRCm39) missense probably damaging 1.00
IGL03401:Pum1 APN 4 130,470,992 (GRCm39) splice site probably benign
LCD18:Pum1 UTSW 4 130,730,549 (GRCm38) intron probably benign
R0077:Pum1 UTSW 4 130,499,985 (GRCm39) missense probably benign 0.06
R0346:Pum1 UTSW 4 130,507,116 (GRCm39) missense possibly damaging 0.74
R0632:Pum1 UTSW 4 130,455,415 (GRCm39) missense probably benign 0.34
R0870:Pum1 UTSW 4 130,496,155 (GRCm39) missense probably damaging 0.99
R1006:Pum1 UTSW 4 130,499,199 (GRCm39) missense probably damaging 0.98
R1300:Pum1 UTSW 4 130,493,272 (GRCm39) missense probably damaging 1.00
R1499:Pum1 UTSW 4 130,446,567 (GRCm39) missense probably damaging 1.00
R1572:Pum1 UTSW 4 130,445,515 (GRCm39) missense probably damaging 0.99
R1835:Pum1 UTSW 4 130,428,359 (GRCm39) missense possibly damaging 0.93
R1864:Pum1 UTSW 4 130,478,836 (GRCm39) missense possibly damaging 0.90
R1991:Pum1 UTSW 4 130,445,529 (GRCm39) missense possibly damaging 0.93
R2068:Pum1 UTSW 4 130,501,745 (GRCm39) missense probably benign 0.02
R2119:Pum1 UTSW 4 130,396,581 (GRCm39) missense possibly damaging 0.92
R2120:Pum1 UTSW 4 130,396,581 (GRCm39) missense possibly damaging 0.92
R2122:Pum1 UTSW 4 130,396,581 (GRCm39) missense possibly damaging 0.92
R2153:Pum1 UTSW 4 130,478,802 (GRCm39) missense probably damaging 1.00
R2164:Pum1 UTSW 4 130,455,395 (GRCm39) missense probably damaging 0.99
R2164:Pum1 UTSW 4 130,455,394 (GRCm39) nonsense probably null
R2280:Pum1 UTSW 4 130,493,322 (GRCm39) missense probably damaging 1.00
R3116:Pum1 UTSW 4 130,499,971 (GRCm39) missense probably damaging 1.00
R3890:Pum1 UTSW 4 130,491,393 (GRCm39) missense probably damaging 1.00
R3891:Pum1 UTSW 4 130,491,393 (GRCm39) missense probably damaging 1.00
R3892:Pum1 UTSW 4 130,491,393 (GRCm39) missense probably damaging 1.00
R4134:Pum1 UTSW 4 130,491,380 (GRCm39) missense probably damaging 1.00
R4258:Pum1 UTSW 4 130,457,591 (GRCm39) missense probably damaging 1.00
R4731:Pum1 UTSW 4 130,445,504 (GRCm39) missense probably benign 0.00
R4732:Pum1 UTSW 4 130,445,504 (GRCm39) missense probably benign 0.00
R4733:Pum1 UTSW 4 130,445,504 (GRCm39) missense probably benign 0.00
R4973:Pum1 UTSW 4 130,396,448 (GRCm39) missense probably benign 0.27
R5198:Pum1 UTSW 4 130,507,190 (GRCm39) nonsense probably null
R5249:Pum1 UTSW 4 130,490,125 (GRCm39) missense probably benign 0.07
R5478:Pum1 UTSW 4 130,478,795 (GRCm39) missense possibly damaging 0.93
R5652:Pum1 UTSW 4 130,491,438 (GRCm39) missense possibly damaging 0.95
R5932:Pum1 UTSW 4 130,457,677 (GRCm39) missense probably benign 0.04
R6008:Pum1 UTSW 4 130,496,158 (GRCm39) missense probably damaging 1.00
R6112:Pum1 UTSW 4 130,457,591 (GRCm39) missense probably damaging 1.00
R6416:Pum1 UTSW 4 130,455,598 (GRCm39) splice site probably null
R6426:Pum1 UTSW 4 130,481,283 (GRCm39) missense probably damaging 1.00
R6431:Pum1 UTSW 4 130,501,816 (GRCm39) missense probably damaging 1.00
R7226:Pum1 UTSW 4 130,499,292 (GRCm39) missense probably damaging 1.00
R7273:Pum1 UTSW 4 130,478,791 (GRCm39) missense probably damaging 0.99
R7423:Pum1 UTSW 4 130,501,856 (GRCm39) missense probably damaging 1.00
R7491:Pum1 UTSW 4 130,446,485 (GRCm39) missense probably benign 0.08
R7526:Pum1 UTSW 4 130,474,337 (GRCm39) missense probably damaging 0.99
R7731:Pum1 UTSW 4 130,490,274 (GRCm39) missense probably benign 0.29
R7911:Pum1 UTSW 4 130,501,788 (GRCm39) missense probably benign 0.40
R8065:Pum1 UTSW 4 130,478,836 (GRCm39) missense possibly damaging 0.90
R8305:Pum1 UTSW 4 130,499,231 (GRCm39) missense probably benign 0.02
R8476:Pum1 UTSW 4 130,480,024 (GRCm39) missense possibly damaging 0.91
R8835:Pum1 UTSW 4 130,471,064 (GRCm39) missense probably damaging 1.00
R8875:Pum1 UTSW 4 130,507,186 (GRCm39) missense possibly damaging 0.60
R9003:Pum1 UTSW 4 130,474,393 (GRCm39) missense probably benign 0.00
R9072:Pum1 UTSW 4 130,480,172 (GRCm39) missense probably damaging 1.00
R9073:Pum1 UTSW 4 130,480,172 (GRCm39) missense probably damaging 1.00
R9332:Pum1 UTSW 4 130,499,209 (GRCm39) nonsense probably null
R9496:Pum1 UTSW 4 130,446,664 (GRCm39) critical splice donor site probably null
R9801:Pum1 UTSW 4 130,481,328 (GRCm39) missense probably benign 0.28
X0024:Pum1 UTSW 4 130,507,101 (GRCm39) missense probably benign 0.00
Z1177:Pum1 UTSW 4 130,478,790 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGGAGGACTTTCCACCTAATACC -3'
(R):5'- ATGCCTTGCAGCTACTGAC -3'

Sequencing Primer
(F):5'- ACCTAATACCTTGCATGGTGG -3'
(R):5'- TGCAGCTACTGACTCTCTGAAAG -3'
Posted On 2020-01-23