Incidental Mutation 'R8067:Plekhn1'
ID 620052
Institutional Source Beutler Lab
Gene Symbol Plekhn1
Ensembl Gene ENSMUSG00000078485
Gene Name pleckstrin homology domain containing, family N member 1
Synonyms
MMRRC Submission 067502-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R8067 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 156305913-156312999 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 156312697 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 54 (I54V)
Ref Sequence ENSEMBL: ENSMUSP00000151311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105569] [ENSMUST00000105571] [ENSMUST00000217885] [ENSMUST00000218699]
AlphaFold Q8C886
Predicted Effect probably benign
Transcript: ENSMUST00000105569
SMART Domains Protein: ENSMUSP00000101194
Gene: ENSMUSG00000078485

DomainStartEndE-ValueType
low complexity region 20 50 N/A INTRINSIC
BTB 90 187 3.55e-30 SMART
BACK 192 294 1.08e-42 SMART
Kelch 341 387 4.01e-8 SMART
Kelch 388 434 5.41e-14 SMART
Kelch 435 481 6.97e-17 SMART
Kelch 482 528 1.55e-14 SMART
Kelch 529 575 2.02e-13 SMART
Kelch 576 622 1.34e-9 SMART
low complexity region 626 640 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105571
AA Change: I54V

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101196
Gene: ENSMUSG00000078485
AA Change: I54V

DomainStartEndE-ValueType
PH 96 192 4.6e-4 SMART
PH 227 324 8.34e-2 SMART
low complexity region 346 359 N/A INTRINSIC
low complexity region 403 414 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000217885
AA Change: I54V

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000218699
AA Change: I54V

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik A T 8: 13,608,643 (GRCm39) D145E possibly damaging Het
Adcy7 T C 8: 89,037,697 (GRCm39) L255P probably damaging Het
Cbx7 A T 15: 79,818,099 (GRCm39) V1D unknown Het
Cd209c A C 8: 3,995,700 (GRCm39) M34R probably benign Het
Chodl A T 16: 78,743,601 (GRCm39) L229F probably damaging Het
Depdc5 C A 5: 33,053,252 (GRCm39) N197K possibly damaging Het
Dnai1 T A 4: 41,614,258 (GRCm39) D311E probably damaging Het
Dop1a A G 9: 86,400,392 (GRCm39) Y1017C probably benign Het
Dop1b T A 16: 93,562,336 (GRCm39) L927* probably null Het
Dpp10 A G 1: 123,280,389 (GRCm39) S646P probably benign Het
Ebf1 G A 11: 44,511,374 (GRCm39) V90M probably benign Het
Efhd1 C T 1: 87,192,313 (GRCm39) P48S probably benign Het
Fam83b T C 9: 76,398,380 (GRCm39) T908A probably benign Het
Fbxl16 G A 17: 26,036,957 (GRCm39) V313I probably damaging Het
Git2 C T 5: 114,904,579 (GRCm39) M113I probably damaging Het
Gpr87 T A 3: 59,087,308 (GRCm39) I66F probably damaging Het
H60c A C 10: 3,209,338 (GRCm39) L217V unknown Het
Iba57 T C 11: 59,054,086 (GRCm39) probably benign Het
Igkv11-125 C A 6: 67,890,814 (GRCm39) T44N probably benign Het
Itih2 T A 2: 10,128,294 (GRCm39) I136F probably damaging Het
Itpr3 T A 17: 27,329,836 (GRCm39) D1543E probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Mylk A T 16: 34,792,389 (GRCm39) E1570V probably benign Het
N4bp2 T A 5: 65,964,639 (GRCm39) L896H probably damaging Het
Ndc1 T A 4: 107,247,595 (GRCm39) S468T probably benign Het
Ndst3 T C 3: 123,395,094 (GRCm39) N512S probably damaging Het
Or51b6 A G 7: 103,555,610 (GRCm39) probably benign Het
Or5w15 T A 2: 87,568,147 (GRCm39) I174F probably damaging Het
Polr3c T C 3: 96,622,968 (GRCm39) E350G probably null Het
Prpf8 T C 11: 75,390,976 (GRCm39) W1342R probably damaging Het
Pum1 T C 4: 130,478,836 (GRCm39) V486A possibly damaging Het
Rin2 T G 2: 145,702,977 (GRCm39) S558A probably damaging Het
Ripk4 A T 16: 97,564,737 (GRCm39) V58D probably damaging Het
Smyd3 A G 1: 179,238,028 (GRCm39) M113T possibly damaging Het
Spock1 A T 13: 57,843,984 (GRCm39) probably null Het
Srgap3 C T 6: 112,716,325 (GRCm39) R625H probably benign Het
Tasor2 C T 13: 3,619,602 (GRCm39) V2210I probably benign Het
Tmed2 T C 5: 124,684,986 (GRCm39) I134T possibly damaging Het
Washc2 T A 6: 116,201,464 (GRCm39) S353R probably damaging Het
Xdh T A 17: 74,207,652 (GRCm39) R902W probably benign Het
Zbtb5 A T 4: 44,994,972 (GRCm39) S137R probably benign Het
Zfp286 A T 11: 62,644,345 (GRCm39) I192K unknown Het
Zfp942 T C 17: 22,149,391 (GRCm39) Y38C probably damaging Het
Zfpm1 T C 8: 123,062,323 (GRCm39) S461P probably benign Het
Other mutations in Plekhn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Plekhn1 APN 4 156,307,820 (GRCm39) missense probably damaging 1.00
IGL00473:Plekhn1 APN 4 156,307,820 (GRCm39) missense probably damaging 1.00
IGL02104:Plekhn1 APN 4 156,306,865 (GRCm39) missense probably benign 0.25
IGL02122:Plekhn1 APN 4 156,308,313 (GRCm39) critical splice donor site probably null
IGL02210:Plekhn1 APN 4 156,308,106 (GRCm39) missense probably damaging 1.00
PIT4142001:Plekhn1 UTSW 4 156,309,397 (GRCm39) nonsense probably null
PIT4366001:Plekhn1 UTSW 4 156,309,268 (GRCm39) missense probably damaging 0.99
R0123:Plekhn1 UTSW 4 156,312,700 (GRCm39) missense probably benign 0.13
R0134:Plekhn1 UTSW 4 156,312,700 (GRCm39) missense probably benign 0.13
R0225:Plekhn1 UTSW 4 156,312,700 (GRCm39) missense probably benign 0.13
R0276:Plekhn1 UTSW 4 156,312,703 (GRCm39) missense probably damaging 0.99
R0282:Plekhn1 UTSW 4 156,312,780 (GRCm39) splice site probably benign
R0540:Plekhn1 UTSW 4 156,307,204 (GRCm39) missense possibly damaging 0.87
R0569:Plekhn1 UTSW 4 156,309,658 (GRCm39) missense probably damaging 1.00
R0656:Plekhn1 UTSW 4 156,309,821 (GRCm39) missense possibly damaging 0.55
R0798:Plekhn1 UTSW 4 156,312,720 (GRCm39) missense probably damaging 0.96
R0848:Plekhn1 UTSW 4 156,308,021 (GRCm39) critical splice donor site probably null
R1803:Plekhn1 UTSW 4 156,306,838 (GRCm39) missense probably benign 0.20
R2168:Plekhn1 UTSW 4 156,306,339 (GRCm39) missense probably damaging 0.99
R2356:Plekhn1 UTSW 4 156,307,158 (GRCm39) missense probably damaging 1.00
R2516:Plekhn1 UTSW 4 156,307,116 (GRCm39) missense probably damaging 1.00
R3746:Plekhn1 UTSW 4 156,310,051 (GRCm39) missense probably benign 0.00
R3818:Plekhn1 UTSW 4 156,309,990 (GRCm39) missense probably damaging 1.00
R3902:Plekhn1 UTSW 4 156,310,126 (GRCm39) missense possibly damaging 0.75
R4024:Plekhn1 UTSW 4 156,309,207 (GRCm39) missense probably damaging 1.00
R4057:Plekhn1 UTSW 4 156,309,150 (GRCm39) splice site probably null
R4176:Plekhn1 UTSW 4 156,306,258 (GRCm39) missense probably benign 0.02
R4402:Plekhn1 UTSW 4 156,309,813 (GRCm39) missense probably damaging 1.00
R4405:Plekhn1 UTSW 4 156,309,730 (GRCm39) splice site probably null
R4477:Plekhn1 UTSW 4 156,307,856 (GRCm39) missense probably damaging 1.00
R4515:Plekhn1 UTSW 4 156,309,988 (GRCm39) missense probably damaging 1.00
R4517:Plekhn1 UTSW 4 156,309,988 (GRCm39) missense probably damaging 1.00
R4518:Plekhn1 UTSW 4 156,309,988 (GRCm39) missense probably damaging 1.00
R5086:Plekhn1 UTSW 4 156,306,881 (GRCm39) missense probably benign 0.00
R5092:Plekhn1 UTSW 4 156,309,222 (GRCm39) missense possibly damaging 0.93
R5201:Plekhn1 UTSW 4 156,314,984 (GRCm39) missense probably benign 0.00
R5896:Plekhn1 UTSW 4 156,308,331 (GRCm39) missense probably benign 0.02
R5913:Plekhn1 UTSW 4 156,307,152 (GRCm39) missense probably damaging 1.00
R6124:Plekhn1 UTSW 4 156,309,696 (GRCm39) missense possibly damaging 0.87
R6244:Plekhn1 UTSW 4 156,315,015 (GRCm39) splice site probably null
R6263:Plekhn1 UTSW 4 156,309,650 (GRCm39) critical splice donor site probably null
R6430:Plekhn1 UTSW 4 156,306,261 (GRCm39) missense probably benign 0.00
R6703:Plekhn1 UTSW 4 156,309,250 (GRCm39) missense probably benign 0.00
R6723:Plekhn1 UTSW 4 156,309,026 (GRCm39) missense probably damaging 1.00
R6741:Plekhn1 UTSW 4 156,306,249 (GRCm39) missense probably damaging 0.98
R7057:Plekhn1 UTSW 4 156,318,374 (GRCm39) missense probably damaging 0.99
R7135:Plekhn1 UTSW 4 156,307,792 (GRCm39) missense probably benign 0.04
R7347:Plekhn1 UTSW 4 156,307,128 (GRCm39) missense probably benign 0.00
R7408:Plekhn1 UTSW 4 156,318,418 (GRCm39) missense probably benign 0.14
R7423:Plekhn1 UTSW 4 156,315,142 (GRCm39) missense probably benign 0.15
R7500:Plekhn1 UTSW 4 156,317,771 (GRCm39) missense probably benign 0.19
R7613:Plekhn1 UTSW 4 156,309,277 (GRCm39) missense probably benign 0.00
R7626:Plekhn1 UTSW 4 156,310,110 (GRCm39) missense probably benign 0.00
R7738:Plekhn1 UTSW 4 156,316,691 (GRCm39) missense probably damaging 1.00
R8065:Plekhn1 UTSW 4 156,312,697 (GRCm39) missense possibly damaging 0.75
R8744:Plekhn1 UTSW 4 156,318,364 (GRCm39) missense probably damaging 1.00
R8746:Plekhn1 UTSW 4 156,316,682 (GRCm39) missense probably damaging 1.00
R8839:Plekhn1 UTSW 4 156,307,046 (GRCm39) intron probably benign
R8841:Plekhn1 UTSW 4 156,316,655 (GRCm39) missense probably damaging 0.98
R8900:Plekhn1 UTSW 4 156,310,078 (GRCm39) missense possibly damaging 0.87
R9208:Plekhn1 UTSW 4 156,306,859 (GRCm39) missense possibly damaging 0.86
R9723:Plekhn1 UTSW 4 156,306,875 (GRCm39) missense probably benign 0.00
X0023:Plekhn1 UTSW 4 156,306,811 (GRCm39) missense possibly damaging 0.76
X0065:Plekhn1 UTSW 4 156,309,372 (GRCm39) critical splice donor site probably null
Z1176:Plekhn1 UTSW 4 156,307,888 (GRCm39) missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TTTGAATCCCTCCAAGCAGAC -3'
(R):5'- GGCCTCCTTTTCCAGAAAGC -3'

Sequencing Primer
(F):5'- TCCAAGCAGACCAGGGATC -3'
(R):5'- CCTCGCTCAAGGGAAACAGG -3'
Posted On 2020-01-23