Incidental Mutation 'R8067:Depdc5'
ID 620053
Institutional Source Beutler Lab
Gene Symbol Depdc5
Ensembl Gene ENSMUSG00000037426
Gene Name DEP domain containing 5
Synonyms
MMRRC Submission 067502-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8067 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 33021045-33151580 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 33053252 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 197 (N197K)
Ref Sequence ENSEMBL: ENSMUSP00000113862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049780] [ENSMUST00000087897] [ENSMUST00000118698] [ENSMUST00000119705] [ENSMUST00000120902] [ENSMUST00000195980]
AlphaFold P61460
Predicted Effect probably benign
Transcript: ENSMUST00000049780
AA Change: N197K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000052807
Gene: ENSMUSG00000037426
AA Change: N197K

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-64 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087897
AA Change: N197K

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000085207
Gene: ENSMUSG00000037426
AA Change: N197K

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 2.3e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 994 1006 N/A INTRINSIC
low complexity region 1159 1175 N/A INTRINSIC
DEP 1184 1259 2.49e-15 SMART
low complexity region 1322 1335 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118698
AA Change: N197K

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112906
Gene: ENSMUSG00000037426
AA Change: N197K

DomainStartEndE-ValueType
Pfam:DUF3608 100 205 1.9e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119705
AA Change: N197K

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113862
Gene: ENSMUSG00000037426
AA Change: N197K

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3e-117 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1150 1166 N/A INTRINSIC
DEP 1175 1250 2.49e-15 SMART
low complexity region 1313 1326 N/A INTRINSIC
low complexity region 1511 1525 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120902
AA Change: N197K

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426
AA Change: N197K

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1128 1144 N/A INTRINSIC
DEP 1153 1228 2.49e-15 SMART
low complexity region 1291 1304 N/A INTRINSIC
low complexity region 1489 1503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195980
SMART Domains Protein: ENSMUSP00000143228
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 147 4e-7 PFAM
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in neurons exhibit reduced body weight, limb grasping, premature death, spontaneous seizure, increased brain size due to neuron hypertrophy and increased PTZ seizure susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik A T 8: 13,608,643 (GRCm39) D145E possibly damaging Het
Adcy7 T C 8: 89,037,697 (GRCm39) L255P probably damaging Het
Cbx7 A T 15: 79,818,099 (GRCm39) V1D unknown Het
Cd209c A C 8: 3,995,700 (GRCm39) M34R probably benign Het
Chodl A T 16: 78,743,601 (GRCm39) L229F probably damaging Het
Dnai1 T A 4: 41,614,258 (GRCm39) D311E probably damaging Het
Dop1a A G 9: 86,400,392 (GRCm39) Y1017C probably benign Het
Dop1b T A 16: 93,562,336 (GRCm39) L927* probably null Het
Dpp10 A G 1: 123,280,389 (GRCm39) S646P probably benign Het
Ebf1 G A 11: 44,511,374 (GRCm39) V90M probably benign Het
Efhd1 C T 1: 87,192,313 (GRCm39) P48S probably benign Het
Fam83b T C 9: 76,398,380 (GRCm39) T908A probably benign Het
Fbxl16 G A 17: 26,036,957 (GRCm39) V313I probably damaging Het
Git2 C T 5: 114,904,579 (GRCm39) M113I probably damaging Het
Gpr87 T A 3: 59,087,308 (GRCm39) I66F probably damaging Het
H60c A C 10: 3,209,338 (GRCm39) L217V unknown Het
Iba57 T C 11: 59,054,086 (GRCm39) probably benign Het
Igkv11-125 C A 6: 67,890,814 (GRCm39) T44N probably benign Het
Itih2 T A 2: 10,128,294 (GRCm39) I136F probably damaging Het
Itpr3 T A 17: 27,329,836 (GRCm39) D1543E probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Mylk A T 16: 34,792,389 (GRCm39) E1570V probably benign Het
N4bp2 T A 5: 65,964,639 (GRCm39) L896H probably damaging Het
Ndc1 T A 4: 107,247,595 (GRCm39) S468T probably benign Het
Ndst3 T C 3: 123,395,094 (GRCm39) N512S probably damaging Het
Or51b6 A G 7: 103,555,610 (GRCm39) probably benign Het
Or5w15 T A 2: 87,568,147 (GRCm39) I174F probably damaging Het
Plekhn1 T C 4: 156,312,697 (GRCm39) I54V possibly damaging Het
Polr3c T C 3: 96,622,968 (GRCm39) E350G probably null Het
Prpf8 T C 11: 75,390,976 (GRCm39) W1342R probably damaging Het
Pum1 T C 4: 130,478,836 (GRCm39) V486A possibly damaging Het
Rin2 T G 2: 145,702,977 (GRCm39) S558A probably damaging Het
Ripk4 A T 16: 97,564,737 (GRCm39) V58D probably damaging Het
Smyd3 A G 1: 179,238,028 (GRCm39) M113T possibly damaging Het
Spock1 A T 13: 57,843,984 (GRCm39) probably null Het
Srgap3 C T 6: 112,716,325 (GRCm39) R625H probably benign Het
Tasor2 C T 13: 3,619,602 (GRCm39) V2210I probably benign Het
Tmed2 T C 5: 124,684,986 (GRCm39) I134T possibly damaging Het
Washc2 T A 6: 116,201,464 (GRCm39) S353R probably damaging Het
Xdh T A 17: 74,207,652 (GRCm39) R902W probably benign Het
Zbtb5 A T 4: 44,994,972 (GRCm39) S137R probably benign Het
Zfp286 A T 11: 62,644,345 (GRCm39) I192K unknown Het
Zfp942 T C 17: 22,149,391 (GRCm39) Y38C probably damaging Het
Zfpm1 T C 8: 123,062,323 (GRCm39) S461P probably benign Het
Other mutations in Depdc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Depdc5 APN 5 33,125,158 (GRCm39) splice site probably null
IGL01019:Depdc5 APN 5 33,050,745 (GRCm39) missense probably damaging 0.96
IGL01067:Depdc5 APN 5 33,056,411 (GRCm39) splice site probably null
IGL01405:Depdc5 APN 5 33,095,033 (GRCm39) missense possibly damaging 0.90
IGL01577:Depdc5 APN 5 33,113,241 (GRCm39) missense possibly damaging 0.49
IGL01633:Depdc5 APN 5 33,081,544 (GRCm39) missense probably damaging 1.00
IGL01998:Depdc5 APN 5 33,102,495 (GRCm39) splice site probably benign
IGL02025:Depdc5 APN 5 33,103,976 (GRCm39) critical splice acceptor site probably null
IGL02167:Depdc5 APN 5 33,061,145 (GRCm39) missense probably damaging 1.00
IGL02537:Depdc5 APN 5 33,125,131 (GRCm39) missense probably damaging 1.00
IGL02812:Depdc5 APN 5 33,050,712 (GRCm39) splice site probably benign
IGL03001:Depdc5 APN 5 33,102,434 (GRCm39) missense possibly damaging 0.74
IGL03253:Depdc5 APN 5 33,026,157 (GRCm39) unclassified probably benign
alligator UTSW 5 33,121,851 (GRCm39) splice site probably null
lagarto UTSW 5 33,136,852 (GRCm39) missense probably damaging 1.00
sauros UTSW 5 33,144,310 (GRCm39) missense possibly damaging 0.92
IGL02988:Depdc5 UTSW 5 33,113,511 (GRCm39) splice site probably null
R0038:Depdc5 UTSW 5 33,026,197 (GRCm39) missense probably benign 0.01
R0038:Depdc5 UTSW 5 33,026,197 (GRCm39) missense probably benign 0.01
R0153:Depdc5 UTSW 5 33,091,281 (GRCm39) splice site probably benign
R0179:Depdc5 UTSW 5 33,058,918 (GRCm39) unclassified probably benign
R0212:Depdc5 UTSW 5 33,069,586 (GRCm39) missense probably benign 0.00
R0239:Depdc5 UTSW 5 33,100,584 (GRCm39) missense probably damaging 1.00
R0239:Depdc5 UTSW 5 33,100,584 (GRCm39) missense probably damaging 1.00
R0302:Depdc5 UTSW 5 33,061,890 (GRCm39) critical splice donor site probably benign
R0511:Depdc5 UTSW 5 33,102,372 (GRCm39) nonsense probably null
R0677:Depdc5 UTSW 5 33,058,814 (GRCm39) missense probably damaging 1.00
R0884:Depdc5 UTSW 5 33,075,322 (GRCm39) missense possibly damaging 0.94
R0973:Depdc5 UTSW 5 33,144,310 (GRCm39) missense possibly damaging 0.92
R1314:Depdc5 UTSW 5 33,034,418 (GRCm39) missense probably damaging 1.00
R1611:Depdc5 UTSW 5 33,148,297 (GRCm39) missense probably damaging 1.00
R1687:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R1748:Depdc5 UTSW 5 33,075,286 (GRCm39) missense probably benign 0.24
R1903:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R1956:Depdc5 UTSW 5 33,061,175 (GRCm39) missense probably damaging 1.00
R1997:Depdc5 UTSW 5 33,059,250 (GRCm39) critical splice donor site probably null
R2079:Depdc5 UTSW 5 33,104,018 (GRCm39) missense possibly damaging 0.75
R2131:Depdc5 UTSW 5 33,148,125 (GRCm39) nonsense probably null
R2291:Depdc5 UTSW 5 33,136,746 (GRCm39) missense probably damaging 1.00
R2422:Depdc5 UTSW 5 33,148,379 (GRCm39) missense probably damaging 1.00
R2851:Depdc5 UTSW 5 33,081,515 (GRCm39) missense probably damaging 0.96
R2852:Depdc5 UTSW 5 33,081,515 (GRCm39) missense probably damaging 0.96
R2937:Depdc5 UTSW 5 33,058,965 (GRCm39) splice site probably null
R2938:Depdc5 UTSW 5 33,058,965 (GRCm39) splice site probably null
R2974:Depdc5 UTSW 5 33,091,361 (GRCm39) critical splice donor site probably null
R3884:Depdc5 UTSW 5 33,101,421 (GRCm39) missense probably damaging 1.00
R3967:Depdc5 UTSW 5 33,101,459 (GRCm39) nonsense probably null
R4118:Depdc5 UTSW 5 33,121,979 (GRCm39) missense probably damaging 1.00
R4197:Depdc5 UTSW 5 33,148,547 (GRCm39) missense possibly damaging 0.93
R4407:Depdc5 UTSW 5 33,061,878 (GRCm39) critical splice donor site probably null
R4534:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R4535:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R4538:Depdc5 UTSW 5 33,141,290 (GRCm39) missense probably damaging 1.00
R4613:Depdc5 UTSW 5 33,132,790 (GRCm39) missense probably damaging 1.00
R4736:Depdc5 UTSW 5 33,132,666 (GRCm39) missense probably benign
R4738:Depdc5 UTSW 5 33,132,666 (GRCm39) missense probably benign
R4765:Depdc5 UTSW 5 33,094,979 (GRCm39) missense probably damaging 1.00
R5021:Depdc5 UTSW 5 33,136,758 (GRCm39) missense probably damaging 1.00
R5259:Depdc5 UTSW 5 33,095,635 (GRCm39) missense probably damaging 1.00
R5261:Depdc5 UTSW 5 33,095,635 (GRCm39) missense probably damaging 1.00
R5541:Depdc5 UTSW 5 33,021,973 (GRCm39) utr 5 prime probably benign
R5594:Depdc5 UTSW 5 33,058,834 (GRCm39) missense possibly damaging 0.46
R5929:Depdc5 UTSW 5 33,132,850 (GRCm39) nonsense probably null
R6132:Depdc5 UTSW 5 33,067,811 (GRCm39) missense probably damaging 0.99
R6146:Depdc5 UTSW 5 33,126,075 (GRCm39) missense probably benign 0.01
R6336:Depdc5 UTSW 5 33,121,851 (GRCm39) splice site probably null
R6468:Depdc5 UTSW 5 33,069,575 (GRCm39) missense probably benign 0.02
R6911:Depdc5 UTSW 5 33,081,536 (GRCm39) missense probably damaging 1.00
R6969:Depdc5 UTSW 5 33,141,204 (GRCm39) missense probably damaging 1.00
R7002:Depdc5 UTSW 5 33,034,502 (GRCm39) splice site probably null
R7066:Depdc5 UTSW 5 33,059,192 (GRCm39) missense probably benign 0.08
R7231:Depdc5 UTSW 5 33,059,209 (GRCm39) missense possibly damaging 0.92
R7264:Depdc5 UTSW 5 33,125,089 (GRCm39) missense probably benign
R7302:Depdc5 UTSW 5 33,136,852 (GRCm39) missense probably damaging 1.00
R7386:Depdc5 UTSW 5 33,085,280 (GRCm39) missense probably benign
R7564:Depdc5 UTSW 5 33,058,854 (GRCm39) missense probably damaging 1.00
R7636:Depdc5 UTSW 5 33,075,327 (GRCm39) missense probably benign
R7795:Depdc5 UTSW 5 33,101,447 (GRCm39) missense probably damaging 1.00
R7845:Depdc5 UTSW 5 33,061,259 (GRCm39) splice site probably null
R8013:Depdc5 UTSW 5 33,131,186 (GRCm39) missense probably benign 0.01
R8037:Depdc5 UTSW 5 33,116,692 (GRCm39) critical splice donor site probably null
R8038:Depdc5 UTSW 5 33,116,692 (GRCm39) critical splice donor site probably null
R8065:Depdc5 UTSW 5 33,053,252 (GRCm39) missense possibly damaging 0.89
R8108:Depdc5 UTSW 5 33,102,393 (GRCm39) missense probably benign 0.01
R8112:Depdc5 UTSW 5 33,126,050 (GRCm39) missense possibly damaging 0.67
R8213:Depdc5 UTSW 5 33,094,981 (GRCm39) missense probably damaging 1.00
R8382:Depdc5 UTSW 5 33,085,242 (GRCm39) missense probably benign 0.00
R8680:Depdc5 UTSW 5 33,101,382 (GRCm39) missense possibly damaging 0.48
R8743:Depdc5 UTSW 5 33,081,587 (GRCm39) missense probably benign 0.10
R8754:Depdc5 UTSW 5 33,136,881 (GRCm39) missense probably benign 0.00
R9157:Depdc5 UTSW 5 33,102,452 (GRCm39) missense probably damaging 0.98
R9364:Depdc5 UTSW 5 33,122,076 (GRCm39) missense probably benign
R9441:Depdc5 UTSW 5 33,095,042 (GRCm39) missense probably benign 0.03
R9450:Depdc5 UTSW 5 33,091,354 (GRCm39) missense probably benign
R9459:Depdc5 UTSW 5 33,148,117 (GRCm39) missense probably damaging 0.99
R9554:Depdc5 UTSW 5 33,122,076 (GRCm39) missense probably benign
R9569:Depdc5 UTSW 5 33,025,321 (GRCm39) missense probably damaging 0.98
R9647:Depdc5 UTSW 5 33,081,567 (GRCm39) missense possibly damaging 0.94
R9688:Depdc5 UTSW 5 33,055,276 (GRCm39) nonsense probably null
X0027:Depdc5 UTSW 5 33,061,636 (GRCm39) missense probably damaging 1.00
Z1176:Depdc5 UTSW 5 33,100,626 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGTCTAGTGTATTTAAGTAGCTCCTCC -3'
(R):5'- AGGTTGACCAATAGCCCACAG -3'

Sequencing Primer
(F):5'- CTGGCTGGAACTTGCTATATAGAGC -3'
(R):5'- AGTTCAAGGTCATCACTGGC -3'
Posted On 2020-01-23