Incidental Mutation 'R8067:N4bp2'
ID 620054
Institutional Source Beutler Lab
Gene Symbol N4bp2
Ensembl Gene ENSMUSG00000037795
Gene Name NEDD4 binding protein 2
Synonyms LOC333789, B3bp, LOC386488
MMRRC Submission 067502-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.190) question?
Stock # R8067 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 65920864-65987451 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 65964639 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 896 (L896H)
Ref Sequence ENSEMBL: ENSMUSP00000144278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087264] [ENSMUST00000201489] [ENSMUST00000201615]
AlphaFold F8VQG7
Predicted Effect probably damaging
Transcript: ENSMUST00000087264
AA Change: L896H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000084519
Gene: ENSMUSG00000037795
AA Change: L896H

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1.1e-15 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 1e-9 BLAST
low complexity region 1496 1511 N/A INTRINSIC
DUF1771 1526 1591 1.88e-21 SMART
SMR 1596 1678 1.09e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201489
AA Change: L896H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143807
Gene: ENSMUSG00000037795
AA Change: L896H

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1e-14 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 1e-9 BLAST
low complexity region 1496 1511 N/A INTRINSIC
DUF1771 1526 1591 1.88e-21 SMART
SMR 1596 1678 1.09e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201615
AA Change: L896H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144278
Gene: ENSMUSG00000037795
AA Change: L896H

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1.2e-14 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 8e-10 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a polynucleotide kinase domain (PNK) near the N-terminal region, and a Small MutS Related (Smr) domain near the C-terminal region. The encoded protein can bind to both B-cell leukemia/lymphoma 3 (BCL-3) and neural precursor cell expressed, developmentally downregulated 4, (Nedd4) proteins. This protein binds and hydrolyzes ATP, may function as a 5'-polynucleotide kinase, and has the capacity to be a ubiquitylation substrate. This protein may play a role in transcription-coupled DNA repair or genetic recombination. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik A T 8: 13,608,643 (GRCm39) D145E possibly damaging Het
Adcy7 T C 8: 89,037,697 (GRCm39) L255P probably damaging Het
Cbx7 A T 15: 79,818,099 (GRCm39) V1D unknown Het
Cd209c A C 8: 3,995,700 (GRCm39) M34R probably benign Het
Chodl A T 16: 78,743,601 (GRCm39) L229F probably damaging Het
Depdc5 C A 5: 33,053,252 (GRCm39) N197K possibly damaging Het
Dnai1 T A 4: 41,614,258 (GRCm39) D311E probably damaging Het
Dop1a A G 9: 86,400,392 (GRCm39) Y1017C probably benign Het
Dop1b T A 16: 93,562,336 (GRCm39) L927* probably null Het
Dpp10 A G 1: 123,280,389 (GRCm39) S646P probably benign Het
Ebf1 G A 11: 44,511,374 (GRCm39) V90M probably benign Het
Efhd1 C T 1: 87,192,313 (GRCm39) P48S probably benign Het
Fam83b T C 9: 76,398,380 (GRCm39) T908A probably benign Het
Fbxl16 G A 17: 26,036,957 (GRCm39) V313I probably damaging Het
Git2 C T 5: 114,904,579 (GRCm39) M113I probably damaging Het
Gpr87 T A 3: 59,087,308 (GRCm39) I66F probably damaging Het
H60c A C 10: 3,209,338 (GRCm39) L217V unknown Het
Iba57 T C 11: 59,054,086 (GRCm39) probably benign Het
Igkv11-125 C A 6: 67,890,814 (GRCm39) T44N probably benign Het
Itih2 T A 2: 10,128,294 (GRCm39) I136F probably damaging Het
Itpr3 T A 17: 27,329,836 (GRCm39) D1543E probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Mylk A T 16: 34,792,389 (GRCm39) E1570V probably benign Het
Ndc1 T A 4: 107,247,595 (GRCm39) S468T probably benign Het
Ndst3 T C 3: 123,395,094 (GRCm39) N512S probably damaging Het
Or51b6 A G 7: 103,555,610 (GRCm39) probably benign Het
Or5w15 T A 2: 87,568,147 (GRCm39) I174F probably damaging Het
Plekhn1 T C 4: 156,312,697 (GRCm39) I54V possibly damaging Het
Polr3c T C 3: 96,622,968 (GRCm39) E350G probably null Het
Prpf8 T C 11: 75,390,976 (GRCm39) W1342R probably damaging Het
Pum1 T C 4: 130,478,836 (GRCm39) V486A possibly damaging Het
Rin2 T G 2: 145,702,977 (GRCm39) S558A probably damaging Het
Ripk4 A T 16: 97,564,737 (GRCm39) V58D probably damaging Het
Smyd3 A G 1: 179,238,028 (GRCm39) M113T possibly damaging Het
Spock1 A T 13: 57,843,984 (GRCm39) probably null Het
Srgap3 C T 6: 112,716,325 (GRCm39) R625H probably benign Het
Tasor2 C T 13: 3,619,602 (GRCm39) V2210I probably benign Het
Tmed2 T C 5: 124,684,986 (GRCm39) I134T possibly damaging Het
Washc2 T A 6: 116,201,464 (GRCm39) S353R probably damaging Het
Xdh T A 17: 74,207,652 (GRCm39) R902W probably benign Het
Zbtb5 A T 4: 44,994,972 (GRCm39) S137R probably benign Het
Zfp286 A T 11: 62,644,345 (GRCm39) I192K unknown Het
Zfp942 T C 17: 22,149,391 (GRCm39) Y38C probably damaging Het
Zfpm1 T C 8: 123,062,323 (GRCm39) S461P probably benign Het
Other mutations in N4bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:N4bp2 APN 5 65,964,867 (GRCm39) missense probably damaging 0.96
IGL01503:N4bp2 APN 5 65,960,890 (GRCm39) nonsense probably null 0.00
IGL01621:N4bp2 APN 5 65,948,267 (GRCm39) missense probably damaging 1.00
IGL02109:N4bp2 APN 5 65,955,477 (GRCm39) missense probably damaging 1.00
IGL02286:N4bp2 APN 5 65,960,895 (GRCm39) missense probably damaging 1.00
1mM(1):N4bp2 UTSW 5 65,965,020 (GRCm39) missense probably damaging 1.00
IGL03046:N4bp2 UTSW 5 65,948,303 (GRCm39) missense probably damaging 1.00
R0164:N4bp2 UTSW 5 65,960,916 (GRCm39) splice site probably benign
R0285:N4bp2 UTSW 5 65,963,902 (GRCm39) missense probably benign 0.00
R0366:N4bp2 UTSW 5 65,963,739 (GRCm39) missense possibly damaging 0.95
R0548:N4bp2 UTSW 5 65,965,496 (GRCm39) missense probably benign 0.39
R0551:N4bp2 UTSW 5 65,977,684 (GRCm39) splice site probably null
R0671:N4bp2 UTSW 5 65,964,780 (GRCm39) missense probably damaging 0.99
R1136:N4bp2 UTSW 5 65,965,815 (GRCm39) missense probably damaging 1.00
R1515:N4bp2 UTSW 5 65,947,841 (GRCm39) missense probably benign 0.01
R1597:N4bp2 UTSW 5 65,964,483 (GRCm39) missense probably benign 0.45
R1628:N4bp2 UTSW 5 65,960,915 (GRCm39) splice site probably null
R1722:N4bp2 UTSW 5 65,964,225 (GRCm39) missense probably benign 0.08
R1735:N4bp2 UTSW 5 65,965,659 (GRCm39) missense probably damaging 1.00
R1745:N4bp2 UTSW 5 65,948,165 (GRCm39) missense probably benign 0.12
R1759:N4bp2 UTSW 5 65,983,956 (GRCm39) missense probably damaging 1.00
R1799:N4bp2 UTSW 5 65,964,168 (GRCm39) missense possibly damaging 0.62
R1846:N4bp2 UTSW 5 65,965,862 (GRCm39) missense probably damaging 1.00
R1872:N4bp2 UTSW 5 65,951,861 (GRCm39) splice site probably benign
R2042:N4bp2 UTSW 5 65,983,964 (GRCm39) missense probably damaging 1.00
R2082:N4bp2 UTSW 5 65,964,908 (GRCm39) missense probably damaging 1.00
R2101:N4bp2 UTSW 5 65,948,224 (GRCm39) missense probably damaging 1.00
R2147:N4bp2 UTSW 5 65,966,543 (GRCm39) missense probably damaging 1.00
R2251:N4bp2 UTSW 5 65,964,071 (GRCm39) missense probably damaging 1.00
R2507:N4bp2 UTSW 5 65,947,404 (GRCm39) missense probably benign 0.01
R2508:N4bp2 UTSW 5 65,947,404 (GRCm39) missense probably benign 0.01
R2919:N4bp2 UTSW 5 65,964,441 (GRCm39) missense probably benign 0.22
R3086:N4bp2 UTSW 5 65,948,396 (GRCm39) missense probably damaging 1.00
R4092:N4bp2 UTSW 5 65,947,799 (GRCm39) missense probably benign 0.02
R4177:N4bp2 UTSW 5 65,955,513 (GRCm39) splice site probably null
R4718:N4bp2 UTSW 5 65,960,806 (GRCm39) missense probably damaging 1.00
R4859:N4bp2 UTSW 5 65,982,641 (GRCm39) missense probably damaging 1.00
R4863:N4bp2 UTSW 5 65,965,473 (GRCm39) missense probably benign 0.22
R4915:N4bp2 UTSW 5 65,960,847 (GRCm39) missense probably damaging 1.00
R4949:N4bp2 UTSW 5 65,979,142 (GRCm39) splice site probably null
R4978:N4bp2 UTSW 5 65,947,583 (GRCm39) missense probably damaging 1.00
R5029:N4bp2 UTSW 5 65,972,123 (GRCm39) missense probably damaging 1.00
R5079:N4bp2 UTSW 5 65,969,320 (GRCm39) missense probably damaging 1.00
R5097:N4bp2 UTSW 5 65,974,561 (GRCm39) missense probably damaging 1.00
R5158:N4bp2 UTSW 5 65,965,805 (GRCm39) missense probably damaging 0.99
R5228:N4bp2 UTSW 5 65,964,861 (GRCm39) missense probably benign
R5322:N4bp2 UTSW 5 65,947,800 (GRCm39) missense possibly damaging 0.76
R5554:N4bp2 UTSW 5 65,965,457 (GRCm39) missense probably benign 0.44
R5731:N4bp2 UTSW 5 65,966,500 (GRCm39) missense probably damaging 1.00
R5840:N4bp2 UTSW 5 65,965,437 (GRCm39) missense probably damaging 0.99
R6393:N4bp2 UTSW 5 65,948,344 (GRCm39) missense possibly damaging 0.81
R6767:N4bp2 UTSW 5 65,974,530 (GRCm39) missense probably damaging 1.00
R7103:N4bp2 UTSW 5 65,964,189 (GRCm39) missense probably benign 0.01
R7112:N4bp2 UTSW 5 65,948,050 (GRCm39) missense possibly damaging 0.74
R7171:N4bp2 UTSW 5 65,965,365 (GRCm39) missense probably benign 0.00
R7177:N4bp2 UTSW 5 65,964,891 (GRCm39) missense probably damaging 1.00
R7240:N4bp2 UTSW 5 65,951,888 (GRCm39) missense probably damaging 0.96
R7353:N4bp2 UTSW 5 65,963,714 (GRCm39) missense probably benign 0.01
R7450:N4bp2 UTSW 5 65,982,643 (GRCm39) nonsense probably null
R7560:N4bp2 UTSW 5 65,948,458 (GRCm39) missense probably damaging 0.99
R7698:N4bp2 UTSW 5 65,965,500 (GRCm39) missense probably benign 0.00
R7743:N4bp2 UTSW 5 65,965,802 (GRCm39) missense probably damaging 1.00
R7871:N4bp2 UTSW 5 65,964,446 (GRCm39) missense probably benign 0.00
R7981:N4bp2 UTSW 5 65,969,485 (GRCm39) missense probably benign 0.41
R8065:N4bp2 UTSW 5 65,964,639 (GRCm39) missense probably damaging 0.99
R8164:N4bp2 UTSW 5 65,966,566 (GRCm39) missense probably damaging 1.00
R8166:N4bp2 UTSW 5 65,977,655 (GRCm39) missense probably benign 0.39
R8331:N4bp2 UTSW 5 65,964,943 (GRCm39) missense probably damaging 1.00
R8559:N4bp2 UTSW 5 65,982,628 (GRCm39) missense possibly damaging 0.62
R8806:N4bp2 UTSW 5 65,965,551 (GRCm39) missense possibly damaging 0.63
R9287:N4bp2 UTSW 5 65,960,855 (GRCm39) missense probably benign 0.38
R9369:N4bp2 UTSW 5 65,964,259 (GRCm39) missense probably damaging 0.97
R9460:N4bp2 UTSW 5 65,963,886 (GRCm39) missense probably benign 0.00
R9462:N4bp2 UTSW 5 65,947,898 (GRCm39) missense probably benign 0.02
R9605:N4bp2 UTSW 5 65,963,879 (GRCm39) missense probably benign 0.02
R9641:N4bp2 UTSW 5 65,948,035 (GRCm39) missense probably benign 0.15
Z1177:N4bp2 UTSW 5 65,964,980 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTTATATCCAGCACACGAGG -3'
(R):5'- AGAGTGAAATCTTTGGGCTTAAACC -3'

Sequencing Primer
(F):5'- AGCACACGAGGCCTACTG -3'
(R):5'- GGCTTAAACCCATCCAATCTTC -3'
Posted On 2020-01-23