Incidental Mutation 'R8067:Washc2'
ID 620060
Institutional Source Beutler Lab
Gene Symbol Washc2
Ensembl Gene ENSMUSG00000024104
Gene Name WASH complex subunit 2
Synonyms C530005J20Rik, D6Wsu116e, Fam21
MMRRC Submission 067502-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8067 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 116184988-116239632 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 116201464 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 353 (S353R)
Ref Sequence ENSEMBL: ENSMUSP00000038983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036759] [ENSMUST00000203286] [ENSMUST00000203928] [ENSMUST00000204283] [ENSMUST00000204476]
AlphaFold Q6PGL7
Predicted Effect probably damaging
Transcript: ENSMUST00000036759
AA Change: S353R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038983
Gene: ENSMUSG00000024104
AA Change: S353R

DomainStartEndE-ValueType
coiled coil region 95 129 N/A INTRINSIC
low complexity region 196 213 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
low complexity region 262 276 N/A INTRINSIC
low complexity region 443 455 N/A INTRINSIC
low complexity region 531 561 N/A INTRINSIC
low complexity region 660 668 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
Pfam:CAP-ZIP_m 939 1074 4.3e-58 PFAM
low complexity region 1268 1282 N/A INTRINSIC
low complexity region 1297 1317 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203286
Predicted Effect probably damaging
Transcript: ENSMUST00000203928
AA Change: S53R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000204283
AA Change: S267R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144703
Gene: ENSMUSG00000024104
AA Change: S267R

DomainStartEndE-ValueType
coiled coil region 9 43 N/A INTRINSIC
low complexity region 110 127 N/A INTRINSIC
low complexity region 130 152 N/A INTRINSIC
low complexity region 176 190 N/A INTRINSIC
low complexity region 357 369 N/A INTRINSIC
low complexity region 445 475 N/A INTRINSIC
low complexity region 574 582 N/A INTRINSIC
low complexity region 715 724 N/A INTRINSIC
Pfam:CAP-ZIP_m 853 988 2.8e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204476
AA Change: S353R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144982
Gene: ENSMUSG00000024104
AA Change: S353R

DomainStartEndE-ValueType
coiled coil region 95 129 N/A INTRINSIC
low complexity region 196 213 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
low complexity region 262 276 N/A INTRINSIC
low complexity region 443 455 N/A INTRINSIC
low complexity region 531 561 N/A INTRINSIC
low complexity region 660 668 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik A T 8: 13,608,643 (GRCm39) D145E possibly damaging Het
Adcy7 T C 8: 89,037,697 (GRCm39) L255P probably damaging Het
Cbx7 A T 15: 79,818,099 (GRCm39) V1D unknown Het
Cd209c A C 8: 3,995,700 (GRCm39) M34R probably benign Het
Chodl A T 16: 78,743,601 (GRCm39) L229F probably damaging Het
Depdc5 C A 5: 33,053,252 (GRCm39) N197K possibly damaging Het
Dnai1 T A 4: 41,614,258 (GRCm39) D311E probably damaging Het
Dop1a A G 9: 86,400,392 (GRCm39) Y1017C probably benign Het
Dop1b T A 16: 93,562,336 (GRCm39) L927* probably null Het
Dpp10 A G 1: 123,280,389 (GRCm39) S646P probably benign Het
Ebf1 G A 11: 44,511,374 (GRCm39) V90M probably benign Het
Efhd1 C T 1: 87,192,313 (GRCm39) P48S probably benign Het
Fam83b T C 9: 76,398,380 (GRCm39) T908A probably benign Het
Fbxl16 G A 17: 26,036,957 (GRCm39) V313I probably damaging Het
Git2 C T 5: 114,904,579 (GRCm39) M113I probably damaging Het
Gpr87 T A 3: 59,087,308 (GRCm39) I66F probably damaging Het
H60c A C 10: 3,209,338 (GRCm39) L217V unknown Het
Iba57 T C 11: 59,054,086 (GRCm39) probably benign Het
Igkv11-125 C A 6: 67,890,814 (GRCm39) T44N probably benign Het
Itih2 T A 2: 10,128,294 (GRCm39) I136F probably damaging Het
Itpr3 T A 17: 27,329,836 (GRCm39) D1543E probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Mylk A T 16: 34,792,389 (GRCm39) E1570V probably benign Het
N4bp2 T A 5: 65,964,639 (GRCm39) L896H probably damaging Het
Ndc1 T A 4: 107,247,595 (GRCm39) S468T probably benign Het
Ndst3 T C 3: 123,395,094 (GRCm39) N512S probably damaging Het
Or51b6 A G 7: 103,555,610 (GRCm39) probably benign Het
Or5w15 T A 2: 87,568,147 (GRCm39) I174F probably damaging Het
Plekhn1 T C 4: 156,312,697 (GRCm39) I54V possibly damaging Het
Polr3c T C 3: 96,622,968 (GRCm39) E350G probably null Het
Prpf8 T C 11: 75,390,976 (GRCm39) W1342R probably damaging Het
Pum1 T C 4: 130,478,836 (GRCm39) V486A possibly damaging Het
Rin2 T G 2: 145,702,977 (GRCm39) S558A probably damaging Het
Ripk4 A T 16: 97,564,737 (GRCm39) V58D probably damaging Het
Smyd3 A G 1: 179,238,028 (GRCm39) M113T possibly damaging Het
Spock1 A T 13: 57,843,984 (GRCm39) probably null Het
Srgap3 C T 6: 112,716,325 (GRCm39) R625H probably benign Het
Tasor2 C T 13: 3,619,602 (GRCm39) V2210I probably benign Het
Tmed2 T C 5: 124,684,986 (GRCm39) I134T possibly damaging Het
Xdh T A 17: 74,207,652 (GRCm39) R902W probably benign Het
Zbtb5 A T 4: 44,994,972 (GRCm39) S137R probably benign Het
Zfp286 A T 11: 62,644,345 (GRCm39) I192K unknown Het
Zfp942 T C 17: 22,149,391 (GRCm39) Y38C probably damaging Het
Zfpm1 T C 8: 123,062,323 (GRCm39) S461P probably benign Het
Other mutations in Washc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Washc2 APN 6 116,233,637 (GRCm39) missense probably benign
IGL00552:Washc2 APN 6 116,233,785 (GRCm39) missense possibly damaging 0.85
IGL01397:Washc2 APN 6 116,224,959 (GRCm39) missense probably benign 0.44
IGL01668:Washc2 APN 6 116,239,299 (GRCm39) missense probably damaging 1.00
IGL01982:Washc2 APN 6 116,213,150 (GRCm39) missense probably benign 0.22
IGL02022:Washc2 APN 6 116,236,126 (GRCm39) missense probably benign 0.22
IGL02150:Washc2 APN 6 116,208,593 (GRCm39) splice site probably benign
IGL02224:Washc2 APN 6 116,197,530 (GRCm39) missense possibly damaging 0.70
IGL02553:Washc2 APN 6 116,218,571 (GRCm39) missense probably damaging 0.98
IGL02555:Washc2 APN 6 116,186,061 (GRCm39) missense probably damaging 1.00
IGL02612:Washc2 APN 6 116,197,577 (GRCm39) missense possibly damaging 0.90
IGL02622:Washc2 APN 6 116,190,979 (GRCm39) splice site probably benign
IGL02900:Washc2 APN 6 116,204,435 (GRCm39) missense probably damaging 1.00
IGL03263:Washc2 APN 6 116,215,084 (GRCm39) splice site probably benign
fading UTSW 6 116,231,114 (GRCm39) missense probably damaging 1.00
R0218:Washc2 UTSW 6 116,225,007 (GRCm39) nonsense probably null
R0285:Washc2 UTSW 6 116,198,800 (GRCm39) missense probably damaging 1.00
R0346:Washc2 UTSW 6 116,197,484 (GRCm39) splice site probably benign
R0677:Washc2 UTSW 6 116,221,577 (GRCm39) missense probably damaging 1.00
R0919:Washc2 UTSW 6 116,185,225 (GRCm39) missense probably damaging 1.00
R1144:Washc2 UTSW 6 116,201,495 (GRCm39) missense probably damaging 1.00
R1666:Washc2 UTSW 6 116,200,215 (GRCm39) critical splice donor site probably null
R1687:Washc2 UTSW 6 116,233,673 (GRCm39) missense probably benign 0.06
R1702:Washc2 UTSW 6 116,206,267 (GRCm39) missense probably damaging 0.99
R1740:Washc2 UTSW 6 116,208,593 (GRCm39) splice site probably benign
R1952:Washc2 UTSW 6 116,232,052 (GRCm39) missense possibly damaging 0.92
R1964:Washc2 UTSW 6 116,185,948 (GRCm39) missense probably damaging 0.99
R2039:Washc2 UTSW 6 116,201,400 (GRCm39) missense probably damaging 0.99
R3084:Washc2 UTSW 6 116,204,454 (GRCm39) missense probably benign 0.00
R3552:Washc2 UTSW 6 116,197,529 (GRCm39) missense probably damaging 1.00
R3790:Washc2 UTSW 6 116,224,933 (GRCm39) splice site probably benign
R3949:Washc2 UTSW 6 116,185,165 (GRCm39) utr 5 prime probably benign
R4089:Washc2 UTSW 6 116,233,253 (GRCm39) splice site probably null
R4133:Washc2 UTSW 6 116,235,891 (GRCm39) missense probably damaging 0.99
R4258:Washc2 UTSW 6 116,185,202 (GRCm39) missense probably damaging 1.00
R4510:Washc2 UTSW 6 116,197,517 (GRCm39) missense probably damaging 1.00
R4511:Washc2 UTSW 6 116,197,517 (GRCm39) missense probably damaging 1.00
R4613:Washc2 UTSW 6 116,206,230 (GRCm39) missense probably damaging 1.00
R4614:Washc2 UTSW 6 116,215,135 (GRCm39) missense possibly damaging 0.83
R4794:Washc2 UTSW 6 116,235,610 (GRCm39) missense probably benign 0.03
R5224:Washc2 UTSW 6 116,185,965 (GRCm39) makesense probably null
R5367:Washc2 UTSW 6 116,236,111 (GRCm39) missense probably damaging 1.00
R5602:Washc2 UTSW 6 116,225,056 (GRCm39) missense possibly damaging 0.73
R6013:Washc2 UTSW 6 116,231,114 (GRCm39) missense probably damaging 1.00
R6075:Washc2 UTSW 6 116,204,327 (GRCm39) missense probably benign 0.02
R6086:Washc2 UTSW 6 116,233,177 (GRCm39) splice site probably null
R6344:Washc2 UTSW 6 116,235,719 (GRCm39) missense probably benign 0.08
R6593:Washc2 UTSW 6 116,236,210 (GRCm39) missense probably damaging 1.00
R7048:Washc2 UTSW 6 116,197,544 (GRCm39) missense possibly damaging 0.96
R7062:Washc2 UTSW 6 116,196,949 (GRCm39) missense possibly damaging 0.72
R7241:Washc2 UTSW 6 116,185,168 (GRCm39) start codon destroyed probably null 0.01
R7283:Washc2 UTSW 6 116,204,379 (GRCm39) missense probably damaging 0.99
R7681:Washc2 UTSW 6 116,237,618 (GRCm39) missense probably damaging 0.99
R7810:Washc2 UTSW 6 116,236,020 (GRCm39) missense probably benign
R7908:Washc2 UTSW 6 116,225,106 (GRCm39) missense probably benign
R7923:Washc2 UTSW 6 116,203,385 (GRCm39) missense possibly damaging 0.83
R8224:Washc2 UTSW 6 116,218,457 (GRCm39) missense probably damaging 0.99
R8697:Washc2 UTSW 6 116,206,220 (GRCm39) missense probably benign 0.17
R8841:Washc2 UTSW 6 116,235,916 (GRCm39) missense probably benign 0.16
R8920:Washc2 UTSW 6 116,221,615 (GRCm39) missense possibly damaging 0.92
R8971:Washc2 UTSW 6 116,231,399 (GRCm39) missense probably damaging 0.99
R9010:Washc2 UTSW 6 116,198,823 (GRCm39) missense probably damaging 1.00
R9231:Washc2 UTSW 6 116,235,899 (GRCm39) missense probably benign 0.05
R9257:Washc2 UTSW 6 116,193,069 (GRCm39) nonsense probably null
R9361:Washc2 UTSW 6 116,239,433 (GRCm39) makesense probably null
R9571:Washc2 UTSW 6 116,237,631 (GRCm39) critical splice donor site probably null
R9764:Washc2 UTSW 6 116,186,048 (GRCm39) missense possibly damaging 0.96
X0018:Washc2 UTSW 6 116,185,219 (GRCm39) missense probably null 0.96
Predicted Primers PCR Primer
(F):5'- TGCAGTCCCAGATATACAGAAATCC -3'
(R):5'- AGCCTCTCCTCACATCAAGG -3'

Sequencing Primer
(F):5'- AAGCTGGCCTTAATCCTACCATG -3'
(R):5'- CACCGGGGTAGATAGTATTTCTTAC -3'
Posted On 2020-01-23