Incidental Mutation 'R8067:Cd209c'
ID620062
Institutional Source Beutler Lab
Gene Symbol Cd209c
Ensembl Gene ENSMUSG00000040165
Gene NameCD209c antigen
SynonymsSIGNR2, mSIGNR2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R8067 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location3940222-3954746 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 3945700 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 34 (M34R)
Ref Sequence ENSEMBL: ENSMUSP00000039861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044060] [ENSMUST00000208622]
Predicted Effect probably benign
Transcript: ENSMUST00000044060
AA Change: M34R

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000039861
Gene: ENSMUSG00000040165
AA Change: M34R

DomainStartEndE-ValueType
CLECT 48 169 7.66e-30 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000208622
AA Change: M34R

PolyPhen 2 Score 0.517 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik A T 8: 13,558,643 D145E possibly damaging Het
Adcy7 T C 8: 88,311,069 L255P probably damaging Het
Cbx7 A T 15: 79,933,898 V1D unknown Het
Chodl A T 16: 78,946,713 L229F probably damaging Het
Depdc5 C A 5: 32,895,908 N197K possibly damaging Het
Dnaic1 T A 4: 41,614,258 D311E probably damaging Het
Dopey1 A G 9: 86,518,339 Y1017C probably benign Het
Dopey2 T A 16: 93,765,448 L927* probably null Het
Dpp10 A G 1: 123,352,660 S646P probably benign Het
Ebf1 G A 11: 44,620,547 V90M probably benign Het
Efhd1 C T 1: 87,264,591 P48S probably benign Het
Fam208b C T 13: 3,569,602 V2210I probably benign Het
Fam83b T C 9: 76,491,098 T908A probably benign Het
Fbxl16 G A 17: 25,817,983 V313I probably damaging Het
Git2 C T 5: 114,766,518 M113I probably damaging Het
Gpr87 T A 3: 59,179,887 I66F probably damaging Het
H60c A C 10: 3,259,338 L217V unknown Het
Iba57 T C 11: 59,163,260 probably benign Het
Igkv11-125 C A 6: 67,913,830 T44N probably benign Het
Itih2 T A 2: 10,123,483 I136F probably damaging Het
Itpr3 T A 17: 27,110,862 D1543E probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk A T 16: 34,972,019 E1570V probably benign Het
N4bp2 T A 5: 65,807,296 L896H probably damaging Het
Ndc1 T A 4: 107,390,398 S468T probably benign Het
Ndst3 T C 3: 123,601,445 N512S probably damaging Het
Olfr1138 T A 2: 87,737,803 I174F probably damaging Het
Olfr65 A G 7: 103,906,403 probably benign Het
Plekhn1 T C 4: 156,228,240 I54V possibly damaging Het
Polr3c T C 3: 96,715,652 E350G probably null Het
Prpf8 T C 11: 75,500,150 W1342R probably damaging Het
Pum1 T C 4: 130,751,525 V486A possibly damaging Het
Rin2 T G 2: 145,861,057 S558A probably damaging Het
Ripk4 A T 16: 97,763,537 V58D probably damaging Het
Smyd3 A G 1: 179,410,463 M113T possibly damaging Het
Spock1 A T 13: 57,696,171 probably benign Het
Srgap3 C T 6: 112,739,364 R625H probably benign Het
Tmed2 T C 5: 124,546,923 I134T possibly damaging Het
Washc2 T A 6: 116,224,503 S353R probably damaging Het
Xdh T A 17: 73,900,657 R902W probably benign Het
Zbtb5 A T 4: 44,994,972 S137R probably benign Het
Zfp286 A T 11: 62,753,519 I192K unknown Het
Zfp942 T C 17: 21,930,410 Y38C probably damaging Het
Zfpm1 T C 8: 122,335,584 S461P probably benign Het
Other mutations in Cd209c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Cd209c APN 8 3940339 missense probably damaging 1.00
IGL01340:Cd209c APN 8 3945892 missense probably benign 0.00
IGL02682:Cd209c APN 8 3940324 missense probably damaging 0.99
R1311:Cd209c UTSW 8 3945908 start codon destroyed probably benign
R1859:Cd209c UTSW 8 3944953 missense probably benign
R4374:Cd209c UTSW 8 3954635 exon noncoding transcript
R4375:Cd209c UTSW 8 3954635 exon noncoding transcript
R4377:Cd209c UTSW 8 3954635 exon noncoding transcript
R4769:Cd209c UTSW 8 3944953 missense probably benign
R4786:Cd209c UTSW 8 3945698 missense possibly damaging 0.77
R4841:Cd209c UTSW 8 3945905 missense probably benign 0.00
R4842:Cd209c UTSW 8 3945905 missense probably benign 0.00
R4869:Cd209c UTSW 8 3944077 missense probably benign 0.00
R5333:Cd209c UTSW 8 3944976 missense probably damaging 1.00
R5835:Cd209c UTSW 8 3945699 missense probably benign 0.01
R6369:Cd209c UTSW 8 3944984 missense probably damaging 1.00
R6497:Cd209c UTSW 8 3944122 missense possibly damaging 0.72
R6591:Cd209c UTSW 8 3945680 missense probably benign 0.14
R6691:Cd209c UTSW 8 3945680 missense probably benign 0.14
R7181:Cd209c UTSW 8 3945712 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAACTTCTGGTGGCTCAACC -3'
(R):5'- TGTGACACTTTGTCCACAGC -3'

Sequencing Primer
(F):5'- GTTGTAACTGCTGAGCCATCCAG -3'
(R):5'- CCCGCCTACAGTTTTTAAAAAGAGG -3'
Posted On2020-01-23