Incidental Mutation 'R8067:Zfpm1'
ID 620065
Institutional Source Beutler Lab
Gene Symbol Zfpm1
Ensembl Gene ENSMUSG00000049577
Gene Name zinc finger protein, multitype 1
Synonyms Fog1, Friend of GATA-1
MMRRC Submission 067502-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.797) question?
Stock # R8067 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 123008880-123063990 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 123062323 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 461 (S461P)
Ref Sequence ENSEMBL: ENSMUSP00000058037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054052] [ENSMUST00000127664]
AlphaFold O35615
PDB Structure Solution structure of the third zinc finger domain of FOG-1 [SOLUTION NMR]
Solution structure of the PR domain of FOG-1 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000054052
AA Change: S461P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000058037
Gene: ENSMUSG00000049577
AA Change: S461P

DomainStartEndE-ValueType
low complexity region 32 72 N/A INTRINSIC
low complexity region 86 94 N/A INTRINSIC
ZnF_C2H2 255 275 3.13e1 SMART
ZnF_C2H2 303 327 1.69e-3 SMART
ZnF_C2H2 333 355 1.53e-1 SMART
ZnF_C2H2 361 384 9.46e0 SMART
low complexity region 508 525 N/A INTRINSIC
low complexity region 570 578 N/A INTRINSIC
ZnF_C2H2 590 610 1.41e2 SMART
low complexity region 626 643 N/A INTRINSIC
low complexity region 644 663 N/A INTRINSIC
ZnF_C2H2 696 723 1.78e2 SMART
low complexity region 725 755 N/A INTRINSIC
low complexity region 761 779 N/A INTRINSIC
low complexity region 785 806 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
ZnF_C2H2 836 856 7.77e1 SMART
ZnF_C2H2 868 891 1.96e1 SMART
low complexity region 948 961 N/A INTRINSIC
ZnF_C2H2 963 989 4.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
MGI Phenotype PHENOTYPE: Homozygous mutants have poorly vascularized yolk sacs and small, pale livers. Mutants die between embryonic days 10.5 and 12.5 with severe anemia associated with a block in megakaryocyte development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik A T 8: 13,608,643 (GRCm39) D145E possibly damaging Het
Adcy7 T C 8: 89,037,697 (GRCm39) L255P probably damaging Het
Cbx7 A T 15: 79,818,099 (GRCm39) V1D unknown Het
Cd209c A C 8: 3,995,700 (GRCm39) M34R probably benign Het
Chodl A T 16: 78,743,601 (GRCm39) L229F probably damaging Het
Depdc5 C A 5: 33,053,252 (GRCm39) N197K possibly damaging Het
Dnai1 T A 4: 41,614,258 (GRCm39) D311E probably damaging Het
Dop1a A G 9: 86,400,392 (GRCm39) Y1017C probably benign Het
Dop1b T A 16: 93,562,336 (GRCm39) L927* probably null Het
Dpp10 A G 1: 123,280,389 (GRCm39) S646P probably benign Het
Ebf1 G A 11: 44,511,374 (GRCm39) V90M probably benign Het
Efhd1 C T 1: 87,192,313 (GRCm39) P48S probably benign Het
Fam83b T C 9: 76,398,380 (GRCm39) T908A probably benign Het
Fbxl16 G A 17: 26,036,957 (GRCm39) V313I probably damaging Het
Git2 C T 5: 114,904,579 (GRCm39) M113I probably damaging Het
Gpr87 T A 3: 59,087,308 (GRCm39) I66F probably damaging Het
H60c A C 10: 3,209,338 (GRCm39) L217V unknown Het
Iba57 T C 11: 59,054,086 (GRCm39) probably benign Het
Igkv11-125 C A 6: 67,890,814 (GRCm39) T44N probably benign Het
Itih2 T A 2: 10,128,294 (GRCm39) I136F probably damaging Het
Itpr3 T A 17: 27,329,836 (GRCm39) D1543E probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Mylk A T 16: 34,792,389 (GRCm39) E1570V probably benign Het
N4bp2 T A 5: 65,964,639 (GRCm39) L896H probably damaging Het
Ndc1 T A 4: 107,247,595 (GRCm39) S468T probably benign Het
Ndst3 T C 3: 123,395,094 (GRCm39) N512S probably damaging Het
Or51b6 A G 7: 103,555,610 (GRCm39) probably benign Het
Or5w15 T A 2: 87,568,147 (GRCm39) I174F probably damaging Het
Plekhn1 T C 4: 156,312,697 (GRCm39) I54V possibly damaging Het
Polr3c T C 3: 96,622,968 (GRCm39) E350G probably null Het
Prpf8 T C 11: 75,390,976 (GRCm39) W1342R probably damaging Het
Pum1 T C 4: 130,478,836 (GRCm39) V486A possibly damaging Het
Rin2 T G 2: 145,702,977 (GRCm39) S558A probably damaging Het
Ripk4 A T 16: 97,564,737 (GRCm39) V58D probably damaging Het
Smyd3 A G 1: 179,238,028 (GRCm39) M113T possibly damaging Het
Spock1 A T 13: 57,843,984 (GRCm39) probably null Het
Srgap3 C T 6: 112,716,325 (GRCm39) R625H probably benign Het
Tasor2 C T 13: 3,619,602 (GRCm39) V2210I probably benign Het
Tmed2 T C 5: 124,684,986 (GRCm39) I134T possibly damaging Het
Washc2 T A 6: 116,201,464 (GRCm39) S353R probably damaging Het
Xdh T A 17: 74,207,652 (GRCm39) R902W probably benign Het
Zbtb5 A T 4: 44,994,972 (GRCm39) S137R probably benign Het
Zfp286 A T 11: 62,644,345 (GRCm39) I192K unknown Het
Zfp942 T C 17: 22,149,391 (GRCm39) Y38C probably damaging Het
Other mutations in Zfpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02540:Zfpm1 APN 8 123,058,859 (GRCm39) missense possibly damaging 0.65
R0006:Zfpm1 UTSW 8 123,061,227 (GRCm39) missense probably damaging 1.00
R0508:Zfpm1 UTSW 8 123,061,872 (GRCm39) missense probably damaging 1.00
R0631:Zfpm1 UTSW 8 123,063,613 (GRCm39) intron probably benign
R0729:Zfpm1 UTSW 8 123,063,398 (GRCm39) missense probably benign 0.20
R0883:Zfpm1 UTSW 8 123,062,585 (GRCm39) missense probably damaging 0.99
R1469:Zfpm1 UTSW 8 123,062,585 (GRCm39) missense probably damaging 0.99
R1469:Zfpm1 UTSW 8 123,062,585 (GRCm39) missense probably damaging 0.99
R1509:Zfpm1 UTSW 8 123,034,285 (GRCm39) missense possibly damaging 0.63
R1938:Zfpm1 UTSW 8 123,061,663 (GRCm39) splice site probably null
R2060:Zfpm1 UTSW 8 123,063,331 (GRCm39) missense probably benign 0.37
R3735:Zfpm1 UTSW 8 123,050,475 (GRCm39) missense possibly damaging 0.83
R3736:Zfpm1 UTSW 8 123,050,475 (GRCm39) missense possibly damaging 0.83
R4528:Zfpm1 UTSW 8 123,062,381 (GRCm39) missense probably benign 0.06
R4735:Zfpm1 UTSW 8 123,062,219 (GRCm39) missense probably benign 0.24
R4924:Zfpm1 UTSW 8 123,061,347 (GRCm39) missense possibly damaging 0.95
R5347:Zfpm1 UTSW 8 123,062,269 (GRCm39) missense possibly damaging 0.94
R5375:Zfpm1 UTSW 8 123,062,812 (GRCm39) missense probably benign 0.00
R5470:Zfpm1 UTSW 8 123,060,532 (GRCm39) missense probably damaging 0.99
R6358:Zfpm1 UTSW 8 123,063,850 (GRCm39) intron probably benign
R6768:Zfpm1 UTSW 8 123,061,195 (GRCm39) missense probably damaging 1.00
R6966:Zfpm1 UTSW 8 123,058,904 (GRCm39) missense probably damaging 1.00
R7422:Zfpm1 UTSW 8 123,063,698 (GRCm39) missense unknown
R7782:Zfpm1 UTSW 8 123,063,689 (GRCm39) missense unknown
R8065:Zfpm1 UTSW 8 123,062,323 (GRCm39) missense probably benign 0.00
R8192:Zfpm1 UTSW 8 123,058,833 (GRCm39) missense probably damaging 1.00
R8835:Zfpm1 UTSW 8 123,063,772 (GRCm39) missense unknown
R9308:Zfpm1 UTSW 8 123,034,231 (GRCm39) missense probably benign 0.13
R9342:Zfpm1 UTSW 8 123,061,308 (GRCm39) missense probably benign 0.29
R9698:Zfpm1 UTSW 8 123,063,868 (GRCm39) missense unknown
R9763:Zfpm1 UTSW 8 123,062,531 (GRCm39) missense probably damaging 1.00
Z1192:Zfpm1 UTSW 8 123,060,612 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGCAGCCCTGTGTTCTTG -3'
(R):5'- ATATTGTGGCAGAAAGAGTGTCC -3'

Sequencing Primer
(F):5'- TCTTGTAGACAGCCTGGCAG -3'
(R):5'- AAAGAGTGTCCCGGCCATTG -3'
Posted On 2020-01-23