Incidental Mutation 'R8067:Fam83b'
ID 620066
Institutional Source Beutler Lab
Gene Symbol Fam83b
Ensembl Gene ENSMUSG00000032358
Gene Name family with sequence similarity 83, member B
Synonyms C530008M07Rik
MMRRC Submission 067502-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R8067 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 76397336-76474398 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 76398380 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 908 (T908A)
Ref Sequence ENSEMBL: ENSMUSP00000096146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098546] [ENSMUST00000183437]
AlphaFold Q0VBM2
Predicted Effect probably benign
Transcript: ENSMUST00000098546
AA Change: T908A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096146
Gene: ENSMUSG00000032358
AA Change: T908A

DomainStartEndE-ValueType
Pfam:DUF1669 12 282 5.6e-109 PFAM
Pfam:PLDc_2 139 277 2.4e-12 PFAM
low complexity region 557 574 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 747 760 N/A INTRINSIC
low complexity region 826 846 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183437
AA Change: T908A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139354
Gene: ENSMUSG00000032358
AA Change: T908A

DomainStartEndE-ValueType
Pfam:DUF1669 7 283 2.8e-111 PFAM
Pfam:PLDc_2 139 277 2.4e-9 PFAM
low complexity region 557 574 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 747 760 N/A INTRINSIC
low complexity region 826 846 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik A T 8: 13,608,643 (GRCm39) D145E possibly damaging Het
Adcy7 T C 8: 89,037,697 (GRCm39) L255P probably damaging Het
Cbx7 A T 15: 79,818,099 (GRCm39) V1D unknown Het
Cd209c A C 8: 3,995,700 (GRCm39) M34R probably benign Het
Chodl A T 16: 78,743,601 (GRCm39) L229F probably damaging Het
Depdc5 C A 5: 33,053,252 (GRCm39) N197K possibly damaging Het
Dnai1 T A 4: 41,614,258 (GRCm39) D311E probably damaging Het
Dop1a A G 9: 86,400,392 (GRCm39) Y1017C probably benign Het
Dop1b T A 16: 93,562,336 (GRCm39) L927* probably null Het
Dpp10 A G 1: 123,280,389 (GRCm39) S646P probably benign Het
Ebf1 G A 11: 44,511,374 (GRCm39) V90M probably benign Het
Efhd1 C T 1: 87,192,313 (GRCm39) P48S probably benign Het
Fbxl16 G A 17: 26,036,957 (GRCm39) V313I probably damaging Het
Git2 C T 5: 114,904,579 (GRCm39) M113I probably damaging Het
Gpr87 T A 3: 59,087,308 (GRCm39) I66F probably damaging Het
H60c A C 10: 3,209,338 (GRCm39) L217V unknown Het
Iba57 T C 11: 59,054,086 (GRCm39) probably benign Het
Igkv11-125 C A 6: 67,890,814 (GRCm39) T44N probably benign Het
Itih2 T A 2: 10,128,294 (GRCm39) I136F probably damaging Het
Itpr3 T A 17: 27,329,836 (GRCm39) D1543E probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Mylk A T 16: 34,792,389 (GRCm39) E1570V probably benign Het
N4bp2 T A 5: 65,964,639 (GRCm39) L896H probably damaging Het
Ndc1 T A 4: 107,247,595 (GRCm39) S468T probably benign Het
Ndst3 T C 3: 123,395,094 (GRCm39) N512S probably damaging Het
Or51b6 A G 7: 103,555,610 (GRCm39) probably benign Het
Or5w15 T A 2: 87,568,147 (GRCm39) I174F probably damaging Het
Plekhn1 T C 4: 156,312,697 (GRCm39) I54V possibly damaging Het
Polr3c T C 3: 96,622,968 (GRCm39) E350G probably null Het
Prpf8 T C 11: 75,390,976 (GRCm39) W1342R probably damaging Het
Pum1 T C 4: 130,478,836 (GRCm39) V486A possibly damaging Het
Rin2 T G 2: 145,702,977 (GRCm39) S558A probably damaging Het
Ripk4 A T 16: 97,564,737 (GRCm39) V58D probably damaging Het
Smyd3 A G 1: 179,238,028 (GRCm39) M113T possibly damaging Het
Spock1 A T 13: 57,843,984 (GRCm39) probably null Het
Srgap3 C T 6: 112,716,325 (GRCm39) R625H probably benign Het
Tasor2 C T 13: 3,619,602 (GRCm39) V2210I probably benign Het
Tmed2 T C 5: 124,684,986 (GRCm39) I134T possibly damaging Het
Washc2 T A 6: 116,201,464 (GRCm39) S353R probably damaging Het
Xdh T A 17: 74,207,652 (GRCm39) R902W probably benign Het
Zbtb5 A T 4: 44,994,972 (GRCm39) S137R probably benign Het
Zfp286 A T 11: 62,644,345 (GRCm39) I192K unknown Het
Zfp942 T C 17: 22,149,391 (GRCm39) Y38C probably damaging Het
Zfpm1 T C 8: 123,062,323 (GRCm39) S461P probably benign Het
Other mutations in Fam83b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Fam83b APN 9 76,398,260 (GRCm39) missense probably benign 0.00
IGL01554:Fam83b APN 9 76,409,403 (GRCm39) missense probably benign 0.33
IGL01694:Fam83b APN 9 76,398,272 (GRCm39) missense probably benign 0.13
IGL02009:Fam83b APN 9 76,399,604 (GRCm39) missense probably damaging 1.00
IGL02531:Fam83b APN 9 76,399,282 (GRCm39) missense possibly damaging 0.61
IGL03328:Fam83b APN 9 76,400,324 (GRCm39) missense probably benign 0.01
PIT4581001:Fam83b UTSW 9 76,398,434 (GRCm39) missense probably damaging 1.00
R0110:Fam83b UTSW 9 76,400,108 (GRCm39) missense possibly damaging 0.75
R0469:Fam83b UTSW 9 76,400,108 (GRCm39) missense possibly damaging 0.75
R0510:Fam83b UTSW 9 76,400,108 (GRCm39) missense possibly damaging 0.75
R0732:Fam83b UTSW 9 76,400,210 (GRCm39) nonsense probably null
R0946:Fam83b UTSW 9 76,398,679 (GRCm39) missense probably damaging 0.96
R0961:Fam83b UTSW 9 76,398,577 (GRCm39) missense probably damaging 0.97
R1101:Fam83b UTSW 9 76,452,952 (GRCm39) missense possibly damaging 0.68
R1200:Fam83b UTSW 9 76,399,594 (GRCm39) missense probably damaging 1.00
R1248:Fam83b UTSW 9 76,410,358 (GRCm39) missense probably benign 0.35
R1420:Fam83b UTSW 9 76,399,894 (GRCm39) missense possibly damaging 0.94
R1429:Fam83b UTSW 9 76,399,859 (GRCm39) missense probably benign
R1939:Fam83b UTSW 9 76,400,362 (GRCm39) missense probably damaging 1.00
R1992:Fam83b UTSW 9 76,399,304 (GRCm39) missense probably benign
R2102:Fam83b UTSW 9 76,399,987 (GRCm39) missense probably damaging 0.96
R2134:Fam83b UTSW 9 76,398,298 (GRCm39) missense probably damaging 1.00
R2398:Fam83b UTSW 9 76,409,500 (GRCm39) missense probably damaging 1.00
R2878:Fam83b UTSW 9 76,398,092 (GRCm39) missense probably damaging 1.00
R4092:Fam83b UTSW 9 76,398,943 (GRCm39) missense probably benign 0.24
R4204:Fam83b UTSW 9 76,410,335 (GRCm39) missense probably benign 0.09
R4537:Fam83b UTSW 9 76,399,424 (GRCm39) missense probably benign 0.10
R4920:Fam83b UTSW 9 76,399,150 (GRCm39) missense probably benign
R5456:Fam83b UTSW 9 76,399,877 (GRCm39) missense probably benign
R5473:Fam83b UTSW 9 76,398,782 (GRCm39) missense probably damaging 1.00
R5488:Fam83b UTSW 9 76,452,881 (GRCm39) missense probably benign 0.05
R5489:Fam83b UTSW 9 76,452,881 (GRCm39) missense probably benign 0.05
R5876:Fam83b UTSW 9 76,399,132 (GRCm39) missense possibly damaging 0.92
R6150:Fam83b UTSW 9 76,399,639 (GRCm39) missense probably damaging 1.00
R6374:Fam83b UTSW 9 76,400,189 (GRCm39) missense probably benign 0.31
R6468:Fam83b UTSW 9 76,409,413 (GRCm39) nonsense probably null
R6912:Fam83b UTSW 9 76,398,214 (GRCm39) missense probably damaging 0.99
R7022:Fam83b UTSW 9 76,409,394 (GRCm39) frame shift probably null
R7073:Fam83b UTSW 9 76,453,031 (GRCm39) missense probably benign 0.18
R7356:Fam83b UTSW 9 76,400,135 (GRCm39) missense probably benign 0.05
R7665:Fam83b UTSW 9 76,398,157 (GRCm39) missense probably damaging 1.00
R7762:Fam83b UTSW 9 76,399,714 (GRCm39) missense possibly damaging 0.87
R7790:Fam83b UTSW 9 76,399,330 (GRCm39) missense probably benign 0.01
R7869:Fam83b UTSW 9 76,399,426 (GRCm39) missense possibly damaging 0.78
R7879:Fam83b UTSW 9 76,399,737 (GRCm39) missense possibly damaging 0.76
R7957:Fam83b UTSW 9 76,399,267 (GRCm39) missense probably benign 0.00
R8983:Fam83b UTSW 9 76,400,357 (GRCm39) missense probably damaging 1.00
R9361:Fam83b UTSW 9 76,400,076 (GRCm39) missense probably benign 0.03
R9405:Fam83b UTSW 9 76,398,703 (GRCm39) missense possibly damaging 0.93
R9475:Fam83b UTSW 9 76,399,085 (GRCm39) missense probably benign 0.31
R9656:Fam83b UTSW 9 76,452,863 (GRCm39) missense probably benign 0.02
R9690:Fam83b UTSW 9 76,398,502 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTTCTGGGCGGTTGACATG -3'
(R):5'- AGAAAGCGTTCCTCCTCGTC -3'

Sequencing Primer
(F):5'- ACATGTGTATTTGTAACGCTGCTC -3'
(R):5'- TCCTCGTCAAATTCTCAAGGCAG -3'
Posted On 2020-01-23