Incidental Mutation 'R8067:Dop1a'
ID 620067
Institutional Source Beutler Lab
Gene Symbol Dop1a
Ensembl Gene ENSMUSG00000034973
Gene Name DOP1 leucine zipper like protein A
Synonyms D9Ertd809e, B130005I07Rik, Dopey1
MMRRC Submission 067502-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.338) question?
Stock # R8067 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 86349194-86436683 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86400392 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1017 (Y1017C)
Ref Sequence ENSEMBL: ENSMUSP00000034987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034987] [ENSMUST00000185297] [ENSMUST00000185919] [ENSMUST00000190957]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000034987
AA Change: Y1017C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000034987
Gene: ENSMUSG00000034973
AA Change: Y1017C

DomainStartEndE-ValueType
Pfam:Dopey_N 11 300 1e-117 PFAM
low complexity region 631 649 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 1073 1084 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1296 1318 N/A INTRINSIC
low complexity region 1335 1344 N/A INTRINSIC
low complexity region 1362 1373 N/A INTRINSIC
low complexity region 1575 1589 N/A INTRINSIC
low complexity region 2217 2227 N/A INTRINSIC
low complexity region 2351 2362 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185297
SMART Domains Protein: ENSMUSP00000140258
Gene: ENSMUSG00000034973

DomainStartEndE-ValueType
low complexity region 111 125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185919
AA Change: Y1015C

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000140040
Gene: ENSMUSG00000034973
AA Change: Y1015C

DomainStartEndE-ValueType
Pfam:Dopey_N 10 306 1.9e-106 PFAM
low complexity region 629 647 N/A INTRINSIC
low complexity region 959 971 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
low complexity region 1294 1316 N/A INTRINSIC
low complexity region 1333 1342 N/A INTRINSIC
low complexity region 1360 1371 N/A INTRINSIC
low complexity region 1573 1587 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190957
AA Change: Y1017C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000140740
Gene: ENSMUSG00000034973
AA Change: Y1017C

DomainStartEndE-ValueType
Pfam:Dopey_N 10 305 1.3e-108 PFAM
low complexity region 631 649 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 1073 1084 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1296 1318 N/A INTRINSIC
low complexity region 1335 1344 N/A INTRINSIC
low complexity region 1362 1373 N/A INTRINSIC
low complexity region 1575 1589 N/A INTRINSIC
low complexity region 2217 2227 N/A INTRINSIC
low complexity region 2351 2362 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik A T 8: 13,608,643 (GRCm39) D145E possibly damaging Het
Adcy7 T C 8: 89,037,697 (GRCm39) L255P probably damaging Het
Cbx7 A T 15: 79,818,099 (GRCm39) V1D unknown Het
Cd209c A C 8: 3,995,700 (GRCm39) M34R probably benign Het
Chodl A T 16: 78,743,601 (GRCm39) L229F probably damaging Het
Depdc5 C A 5: 33,053,252 (GRCm39) N197K possibly damaging Het
Dnai1 T A 4: 41,614,258 (GRCm39) D311E probably damaging Het
Dop1b T A 16: 93,562,336 (GRCm39) L927* probably null Het
Dpp10 A G 1: 123,280,389 (GRCm39) S646P probably benign Het
Ebf1 G A 11: 44,511,374 (GRCm39) V90M probably benign Het
Efhd1 C T 1: 87,192,313 (GRCm39) P48S probably benign Het
Fam83b T C 9: 76,398,380 (GRCm39) T908A probably benign Het
Fbxl16 G A 17: 26,036,957 (GRCm39) V313I probably damaging Het
Git2 C T 5: 114,904,579 (GRCm39) M113I probably damaging Het
Gpr87 T A 3: 59,087,308 (GRCm39) I66F probably damaging Het
H60c A C 10: 3,209,338 (GRCm39) L217V unknown Het
Iba57 T C 11: 59,054,086 (GRCm39) probably benign Het
Igkv11-125 C A 6: 67,890,814 (GRCm39) T44N probably benign Het
Itih2 T A 2: 10,128,294 (GRCm39) I136F probably damaging Het
Itpr3 T A 17: 27,329,836 (GRCm39) D1543E probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Mylk A T 16: 34,792,389 (GRCm39) E1570V probably benign Het
N4bp2 T A 5: 65,964,639 (GRCm39) L896H probably damaging Het
Ndc1 T A 4: 107,247,595 (GRCm39) S468T probably benign Het
Ndst3 T C 3: 123,395,094 (GRCm39) N512S probably damaging Het
Or51b6 A G 7: 103,555,610 (GRCm39) probably benign Het
Or5w15 T A 2: 87,568,147 (GRCm39) I174F probably damaging Het
Plekhn1 T C 4: 156,312,697 (GRCm39) I54V possibly damaging Het
Polr3c T C 3: 96,622,968 (GRCm39) E350G probably null Het
Prpf8 T C 11: 75,390,976 (GRCm39) W1342R probably damaging Het
Pum1 T C 4: 130,478,836 (GRCm39) V486A possibly damaging Het
Rin2 T G 2: 145,702,977 (GRCm39) S558A probably damaging Het
Ripk4 A T 16: 97,564,737 (GRCm39) V58D probably damaging Het
Smyd3 A G 1: 179,238,028 (GRCm39) M113T possibly damaging Het
Spock1 A T 13: 57,843,984 (GRCm39) probably null Het
Srgap3 C T 6: 112,716,325 (GRCm39) R625H probably benign Het
Tasor2 C T 13: 3,619,602 (GRCm39) V2210I probably benign Het
Tmed2 T C 5: 124,684,986 (GRCm39) I134T possibly damaging Het
Washc2 T A 6: 116,201,464 (GRCm39) S353R probably damaging Het
Xdh T A 17: 74,207,652 (GRCm39) R902W probably benign Het
Zbtb5 A T 4: 44,994,972 (GRCm39) S137R probably benign Het
Zfp286 A T 11: 62,644,345 (GRCm39) I192K unknown Het
Zfp942 T C 17: 22,149,391 (GRCm39) Y38C probably damaging Het
Zfpm1 T C 8: 123,062,323 (GRCm39) S461P probably benign Het
Other mutations in Dop1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dop1a APN 9 86,433,732 (GRCm39) missense possibly damaging 0.57
IGL00427:Dop1a APN 9 86,403,552 (GRCm39) missense probably damaging 0.96
IGL00427:Dop1a APN 9 86,403,551 (GRCm39) missense possibly damaging 0.93
IGL00427:Dop1a APN 9 86,403,553 (GRCm39) missense probably benign 0.09
IGL00577:Dop1a APN 9 86,402,999 (GRCm39) missense probably damaging 1.00
IGL00741:Dop1a APN 9 86,404,859 (GRCm39) missense possibly damaging 0.50
IGL00959:Dop1a APN 9 86,369,484 (GRCm39) missense probably damaging 1.00
IGL01339:Dop1a APN 9 86,433,730 (GRCm39) missense possibly damaging 0.90
IGL01608:Dop1a APN 9 86,389,614 (GRCm39) missense probably benign 0.23
IGL01760:Dop1a APN 9 86,401,976 (GRCm39) missense probably benign
IGL01788:Dop1a APN 9 86,413,772 (GRCm39) missense probably benign 0.03
IGL01844:Dop1a APN 9 86,396,138 (GRCm39) missense probably damaging 1.00
IGL01923:Dop1a APN 9 86,404,920 (GRCm39) missense probably damaging 1.00
IGL02036:Dop1a APN 9 86,413,818 (GRCm39) missense probably benign 0.18
IGL02308:Dop1a APN 9 86,402,141 (GRCm39) missense probably damaging 0.98
IGL02494:Dop1a APN 9 86,408,871 (GRCm39) missense probably damaging 1.00
IGL02698:Dop1a APN 9 86,406,412 (GRCm39) splice site probably benign
IGL02731:Dop1a APN 9 86,369,434 (GRCm39) missense probably damaging 1.00
IGL02821:Dop1a APN 9 86,402,209 (GRCm39) missense probably benign
IGL02952:Dop1a APN 9 86,414,975 (GRCm39) splice site probably benign
IGL03071:Dop1a APN 9 86,371,668 (GRCm39) missense possibly damaging 0.91
IGL03271:Dop1a APN 9 86,386,275 (GRCm39) nonsense probably null
IGL03344:Dop1a APN 9 86,418,197 (GRCm39) missense probably damaging 1.00
Beg UTSW 9 86,430,225 (GRCm39) nonsense probably null
covet UTSW 9 86,397,396 (GRCm39) missense probably damaging 1.00
crave UTSW 9 86,399,092 (GRCm39) missense probably benign
desire UTSW 9 86,402,109 (GRCm39) missense possibly damaging 0.47
groak UTSW 9 86,403,710 (GRCm39) missense probably damaging 1.00
Querer UTSW 9 86,386,265 (GRCm39) missense probably damaging 1.00
yearn UTSW 9 86,386,220 (GRCm39) splice site probably null
R0055:Dop1a UTSW 9 86,394,705 (GRCm39) missense probably benign 0.08
R0285:Dop1a UTSW 9 86,394,692 (GRCm39) missense probably damaging 1.00
R0415:Dop1a UTSW 9 86,388,555 (GRCm39) missense probably damaging 1.00
R0427:Dop1a UTSW 9 86,389,585 (GRCm39) missense probably damaging 1.00
R0514:Dop1a UTSW 9 86,402,787 (GRCm39) missense probably damaging 1.00
R0538:Dop1a UTSW 9 86,367,550 (GRCm39) missense probably damaging 1.00
R1118:Dop1a UTSW 9 86,397,459 (GRCm39) missense probably damaging 1.00
R1158:Dop1a UTSW 9 86,367,609 (GRCm39) missense probably damaging 1.00
R1272:Dop1a UTSW 9 86,403,477 (GRCm39) missense probably damaging 1.00
R1448:Dop1a UTSW 9 86,424,785 (GRCm39) splice site probably null
R1584:Dop1a UTSW 9 86,430,225 (GRCm39) nonsense probably null
R1601:Dop1a UTSW 9 86,418,303 (GRCm39) missense probably damaging 0.99
R1674:Dop1a UTSW 9 86,418,213 (GRCm39) missense probably damaging 0.98
R1706:Dop1a UTSW 9 86,436,133 (GRCm39) missense possibly damaging 0.92
R1856:Dop1a UTSW 9 86,374,057 (GRCm39) missense probably damaging 0.99
R1926:Dop1a UTSW 9 86,405,072 (GRCm39) missense probably damaging 1.00
R1929:Dop1a UTSW 9 86,376,471 (GRCm39) missense probably damaging 1.00
R2029:Dop1a UTSW 9 86,403,418 (GRCm39) missense probably damaging 1.00
R2125:Dop1a UTSW 9 86,403,099 (GRCm39) missense probably damaging 1.00
R2206:Dop1a UTSW 9 86,403,652 (GRCm39) missense probably benign 0.00
R2271:Dop1a UTSW 9 86,376,471 (GRCm39) missense probably damaging 1.00
R2312:Dop1a UTSW 9 86,403,495 (GRCm39) nonsense probably null
R2379:Dop1a UTSW 9 86,403,138 (GRCm39) missense probably damaging 1.00
R2507:Dop1a UTSW 9 86,395,170 (GRCm39) missense probably damaging 1.00
R3737:Dop1a UTSW 9 86,376,486 (GRCm39) missense probably damaging 1.00
R3804:Dop1a UTSW 9 86,403,048 (GRCm39) missense probably damaging 1.00
R3916:Dop1a UTSW 9 86,403,186 (GRCm39) missense probably damaging 1.00
R3921:Dop1a UTSW 9 86,402,324 (GRCm39) missense probably benign 0.06
R4035:Dop1a UTSW 9 86,376,486 (GRCm39) missense probably damaging 1.00
R4392:Dop1a UTSW 9 86,385,196 (GRCm39) intron probably benign
R4404:Dop1a UTSW 9 86,404,866 (GRCm39) nonsense probably null
R4513:Dop1a UTSW 9 86,402,612 (GRCm39) missense probably benign 0.39
R4624:Dop1a UTSW 9 86,403,578 (GRCm39) missense probably damaging 1.00
R4659:Dop1a UTSW 9 86,384,085 (GRCm39) intron probably benign
R4910:Dop1a UTSW 9 86,374,114 (GRCm39) missense probably damaging 1.00
R4919:Dop1a UTSW 9 86,402,109 (GRCm39) missense possibly damaging 0.47
R5061:Dop1a UTSW 9 86,385,161 (GRCm39) splice site probably benign
R5079:Dop1a UTSW 9 86,369,474 (GRCm39) missense probably damaging 1.00
R5118:Dop1a UTSW 9 86,388,312 (GRCm39) missense probably damaging 1.00
R5169:Dop1a UTSW 9 86,415,074 (GRCm39) missense probably damaging 1.00
R5176:Dop1a UTSW 9 86,403,868 (GRCm39) missense probably damaging 1.00
R5190:Dop1a UTSW 9 86,369,357 (GRCm39) missense probably damaging 1.00
R5256:Dop1a UTSW 9 86,397,381 (GRCm39) missense probably damaging 1.00
R5346:Dop1a UTSW 9 86,402,835 (GRCm39) missense probably damaging 1.00
R5484:Dop1a UTSW 9 86,427,341 (GRCm39) missense probably damaging 1.00
R5501:Dop1a UTSW 9 86,389,783 (GRCm39) missense probably benign 0.04
R5554:Dop1a UTSW 9 86,403,710 (GRCm39) missense probably damaging 1.00
R5707:Dop1a UTSW 9 86,385,050 (GRCm39) missense possibly damaging 0.95
R5826:Dop1a UTSW 9 86,389,623 (GRCm39) missense possibly damaging 0.94
R5921:Dop1a UTSW 9 86,383,975 (GRCm39) missense probably damaging 1.00
R5934:Dop1a UTSW 9 86,424,495 (GRCm39) nonsense probably null
R5936:Dop1a UTSW 9 86,418,565 (GRCm39) nonsense probably null
R6046:Dop1a UTSW 9 86,397,396 (GRCm39) missense probably damaging 1.00
R6053:Dop1a UTSW 9 86,397,347 (GRCm39) missense possibly damaging 0.95
R6072:Dop1a UTSW 9 86,389,750 (GRCm39) missense probably benign 0.00
R6104:Dop1a UTSW 9 86,402,860 (GRCm39) missense possibly damaging 0.86
R6125:Dop1a UTSW 9 86,403,186 (GRCm39) missense probably damaging 1.00
R6299:Dop1a UTSW 9 86,386,265 (GRCm39) missense probably damaging 1.00
R6930:Dop1a UTSW 9 86,413,825 (GRCm39) critical splice donor site probably null
R6949:Dop1a UTSW 9 86,382,913 (GRCm39) missense probably damaging 1.00
R6979:Dop1a UTSW 9 86,403,695 (GRCm39) missense possibly damaging 0.77
R7035:Dop1a UTSW 9 86,406,355 (GRCm39) missense possibly damaging 0.85
R7069:Dop1a UTSW 9 86,432,222 (GRCm39) critical splice donor site probably null
R7101:Dop1a UTSW 9 86,389,722 (GRCm39) missense probably benign
R7202:Dop1a UTSW 9 86,386,220 (GRCm39) splice site probably null
R7222:Dop1a UTSW 9 86,404,929 (GRCm39) critical splice donor site probably null
R7233:Dop1a UTSW 9 86,403,749 (GRCm39) missense probably benign 0.00
R7236:Dop1a UTSW 9 86,397,431 (GRCm39) missense probably damaging 1.00
R7252:Dop1a UTSW 9 86,382,874 (GRCm39) missense probably damaging 1.00
R7268:Dop1a UTSW 9 86,394,830 (GRCm39) nonsense probably null
R7353:Dop1a UTSW 9 86,394,912 (GRCm39) missense probably damaging 0.99
R7481:Dop1a UTSW 9 86,417,985 (GRCm39) missense probably damaging 1.00
R7498:Dop1a UTSW 9 86,376,464 (GRCm39) missense possibly damaging 0.95
R7507:Dop1a UTSW 9 86,418,002 (GRCm39) missense probably benign 0.01
R7525:Dop1a UTSW 9 86,388,343 (GRCm39) missense probably damaging 1.00
R7539:Dop1a UTSW 9 86,403,626 (GRCm39) missense probably benign 0.03
R7751:Dop1a UTSW 9 86,389,783 (GRCm39) missense probably benign 0.00
R7753:Dop1a UTSW 9 86,371,755 (GRCm39) missense possibly damaging 0.52
R7839:Dop1a UTSW 9 86,424,818 (GRCm39) nonsense probably null
R7868:Dop1a UTSW 9 86,384,037 (GRCm39) critical splice donor site probably null
R8061:Dop1a UTSW 9 86,403,246 (GRCm39) missense possibly damaging 0.95
R8156:Dop1a UTSW 9 86,376,510 (GRCm39) missense probably damaging 1.00
R8196:Dop1a UTSW 9 86,405,151 (GRCm39) missense probably benign 0.12
R8223:Dop1a UTSW 9 86,400,345 (GRCm39) missense probably damaging 1.00
R8267:Dop1a UTSW 9 86,396,054 (GRCm39) missense possibly damaging 0.81
R8276:Dop1a UTSW 9 86,399,092 (GRCm39) missense probably benign
R8306:Dop1a UTSW 9 86,402,259 (GRCm39) missense possibly damaging 0.94
R8353:Dop1a UTSW 9 86,403,639 (GRCm39) missense probably damaging 0.97
R8362:Dop1a UTSW 9 86,395,941 (GRCm39) missense probably benign 0.02
R8403:Dop1a UTSW 9 86,382,925 (GRCm39) missense probably damaging 1.00
R8817:Dop1a UTSW 9 86,396,003 (GRCm39) missense possibly damaging 0.91
R8862:Dop1a UTSW 9 86,406,404 (GRCm39) critical splice donor site probably null
R8888:Dop1a UTSW 9 86,403,587 (GRCm39) missense probably benign
R8972:Dop1a UTSW 9 86,403,300 (GRCm39) missense possibly damaging 0.50
R9001:Dop1a UTSW 9 86,436,374 (GRCm39) makesense probably null
R9011:Dop1a UTSW 9 86,397,396 (GRCm39) missense probably damaging 1.00
R9021:Dop1a UTSW 9 86,402,490 (GRCm39) missense probably benign 0.35
R9039:Dop1a UTSW 9 86,382,870 (GRCm39) missense probably damaging 0.99
R9128:Dop1a UTSW 9 86,395,208 (GRCm39) missense probably benign
R9178:Dop1a UTSW 9 86,371,796 (GRCm39) nonsense probably null
R9238:Dop1a UTSW 9 86,415,027 (GRCm39) missense probably benign
R9313:Dop1a UTSW 9 86,406,641 (GRCm39) makesense probably null
R9334:Dop1a UTSW 9 86,403,027 (GRCm39) missense probably damaging 1.00
R9422:Dop1a UTSW 9 86,425,093 (GRCm39) missense probably damaging 1.00
R9562:Dop1a UTSW 9 86,424,811 (GRCm39) missense probably damaging 1.00
R9584:Dop1a UTSW 9 86,385,151 (GRCm39) missense possibly damaging 0.59
R9677:Dop1a UTSW 9 86,425,098 (GRCm39) missense
RF004:Dop1a UTSW 9 86,436,244 (GRCm39) missense probably benign
X0019:Dop1a UTSW 9 86,413,803 (GRCm39) missense probably damaging 0.98
X0019:Dop1a UTSW 9 86,388,280 (GRCm39) missense probably damaging 1.00
ZE80:Dop1a UTSW 9 86,382,895 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCACTGTTCATCATGCTAG -3'
(R):5'- AGCTAGATGGGGTTTTCACAG -3'

Sequencing Primer
(F):5'- CATGACATTGCAAGGGTG -3'
(R):5'- AGCTAGATGGGGTTTTCACAGATGTG -3'
Posted On 2020-01-23