Incidental Mutation 'R8067:H60c'
ID 620068
Institutional Source Beutler Lab
Gene Symbol H60c
Ensembl Gene ENSMUSG00000091618
Gene Name histocompatibility 60c
Synonyms Gm9491, 4632413I24Rik
MMRRC Submission 067502-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R8067 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 3206208-3217771 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 3209338 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Valine at position 217 (L217V)
Ref Sequence ENSEMBL: ENSMUSP00000149470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170893] [ENSMUST00000216211]
AlphaFold B1B213
Predicted Effect unknown
Transcript: ENSMUST00000170893
AA Change: L188V
SMART Domains Protein: ENSMUSP00000126536
Gene: ENSMUSG00000091618
AA Change: L188V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000216211
AA Change: L217V
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik A T 8: 13,608,643 (GRCm39) D145E possibly damaging Het
Adcy7 T C 8: 89,037,697 (GRCm39) L255P probably damaging Het
Cbx7 A T 15: 79,818,099 (GRCm39) V1D unknown Het
Cd209c A C 8: 3,995,700 (GRCm39) M34R probably benign Het
Chodl A T 16: 78,743,601 (GRCm39) L229F probably damaging Het
Depdc5 C A 5: 33,053,252 (GRCm39) N197K possibly damaging Het
Dnai1 T A 4: 41,614,258 (GRCm39) D311E probably damaging Het
Dop1a A G 9: 86,400,392 (GRCm39) Y1017C probably benign Het
Dop1b T A 16: 93,562,336 (GRCm39) L927* probably null Het
Dpp10 A G 1: 123,280,389 (GRCm39) S646P probably benign Het
Ebf1 G A 11: 44,511,374 (GRCm39) V90M probably benign Het
Efhd1 C T 1: 87,192,313 (GRCm39) P48S probably benign Het
Fam83b T C 9: 76,398,380 (GRCm39) T908A probably benign Het
Fbxl16 G A 17: 26,036,957 (GRCm39) V313I probably damaging Het
Git2 C T 5: 114,904,579 (GRCm39) M113I probably damaging Het
Gpr87 T A 3: 59,087,308 (GRCm39) I66F probably damaging Het
Iba57 T C 11: 59,054,086 (GRCm39) probably benign Het
Igkv11-125 C A 6: 67,890,814 (GRCm39) T44N probably benign Het
Itih2 T A 2: 10,128,294 (GRCm39) I136F probably damaging Het
Itpr3 T A 17: 27,329,836 (GRCm39) D1543E probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Mylk A T 16: 34,792,389 (GRCm39) E1570V probably benign Het
N4bp2 T A 5: 65,964,639 (GRCm39) L896H probably damaging Het
Ndc1 T A 4: 107,247,595 (GRCm39) S468T probably benign Het
Ndst3 T C 3: 123,395,094 (GRCm39) N512S probably damaging Het
Or51b6 A G 7: 103,555,610 (GRCm39) probably benign Het
Or5w15 T A 2: 87,568,147 (GRCm39) I174F probably damaging Het
Plekhn1 T C 4: 156,312,697 (GRCm39) I54V possibly damaging Het
Polr3c T C 3: 96,622,968 (GRCm39) E350G probably null Het
Prpf8 T C 11: 75,390,976 (GRCm39) W1342R probably damaging Het
Pum1 T C 4: 130,478,836 (GRCm39) V486A possibly damaging Het
Rin2 T G 2: 145,702,977 (GRCm39) S558A probably damaging Het
Ripk4 A T 16: 97,564,737 (GRCm39) V58D probably damaging Het
Smyd3 A G 1: 179,238,028 (GRCm39) M113T possibly damaging Het
Spock1 A T 13: 57,843,984 (GRCm39) probably null Het
Srgap3 C T 6: 112,716,325 (GRCm39) R625H probably benign Het
Tasor2 C T 13: 3,619,602 (GRCm39) V2210I probably benign Het
Tmed2 T C 5: 124,684,986 (GRCm39) I134T possibly damaging Het
Washc2 T A 6: 116,201,464 (GRCm39) S353R probably damaging Het
Xdh T A 17: 74,207,652 (GRCm39) R902W probably benign Het
Zbtb5 A T 4: 44,994,972 (GRCm39) S137R probably benign Het
Zfp286 A T 11: 62,644,345 (GRCm39) I192K unknown Het
Zfp942 T C 17: 22,149,391 (GRCm39) Y38C probably damaging Het
Zfpm1 T C 8: 123,062,323 (GRCm39) S461P probably benign Het
Other mutations in H60c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:H60c APN 10 3,210,343 (GRCm39) missense probably benign 0.00
IGL01018:H60c APN 10 3,209,766 (GRCm39) missense probably benign 0.00
IGL02089:H60c APN 10 3,209,826 (GRCm39) missense possibly damaging 0.94
IGL03221:H60c APN 10 3,209,799 (GRCm39) nonsense probably null
R0376:H60c UTSW 10 3,210,435 (GRCm39) splice site probably benign
R1456:H60c UTSW 10 3,210,307 (GRCm39) missense possibly damaging 0.90
R1459:H60c UTSW 10 3,210,240 (GRCm39) missense probably benign 0.27
R1737:H60c UTSW 10 3,209,914 (GRCm39) missense possibly damaging 0.89
R2041:H60c UTSW 10 3,209,972 (GRCm39) missense probably damaging 1.00
R3431:H60c UTSW 10 3,210,382 (GRCm39) missense possibly damaging 0.66
R4597:H60c UTSW 10 3,209,968 (GRCm39) missense possibly damaging 0.82
R5186:H60c UTSW 10 3,209,273 (GRCm39) splice site probably null
R6658:H60c UTSW 10 3,210,270 (GRCm39) missense possibly damaging 0.95
R7516:H60c UTSW 10 3,209,746 (GRCm39) nonsense probably null
R7546:H60c UTSW 10 3,209,907 (GRCm39) missense probably damaging 0.97
R8192:H60c UTSW 10 3,209,781 (GRCm39) missense probably benign 0.42
R8696:H60c UTSW 10 3,210,265 (GRCm39) missense possibly damaging 0.59
R8887:H60c UTSW 10 3,217,255 (GRCm39) missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TGACCTGACCTGAATCTCCTG -3'
(R):5'- CACAGCAAAAGGGGTGGATTTC -3'

Sequencing Primer
(F):5'- CTTTCTCAGGAAGAATCTGCAGCTG -3'
(R):5'- CTGTGTGCTGCTGAATTACCCAAG -3'
Posted On 2020-01-23