Mutagenetix > Incidental Mutation

Incidental Mutation 'R8067:Prpf8'

620071

Institutional Source

Beutler Lab

Gene Symbol

Prpf8

Ensembl Gene

ENSMUSG00000020850

Gene Name

pre-mRNA processing factor 8

Synonyms

Sfprp8l, D11Bwg0410e, DBF3/PRP8, Prp8

MMRRC Submission

067502-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.958) question?

Stock #

R8067 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

75377642-75400275 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 75390976 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 1342 (W1342R)

Ref Sequence

ENSEMBL: ENSMUSP00000018449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018449] [ENSMUST00000102510] [ENSMUST00000131283]

AlphaFold

Q99PV0

Predicted Effect

probably damaging
Transcript: ENSMUST00000018449
AA Change: W1342R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000018449
Gene: ENSMUSG00000020850
AA Change: W1342R

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	209	1.6e-84	PFAM
low complexity region	369	388	N/A	INTRINSIC
Pfam:PROCN	393	801	3.6e-226	PFAM
low complexity region	802	814	N/A	INTRINSIC
Pfam:RRM_4	986	1079	7.1e-49	PFAM
Pfam:U5_2-snRNA_bdg	1208	1343	1.9e-73	PFAM
Pfam:U6-snRNA_bdg	1442	1601	3.7e-97	PFAM
Pfam:PRP8_domainIV	1760	1990	1.5e-132	PFAM
JAB_MPN	2099	2233	9.02e-30	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000102510
AA Change: W1342R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000099568
Gene: ENSMUSG00000020850
AA Change: W1342R

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	209	1.6e-90	PFAM
low complexity region	369	388	N/A	INTRINSIC
Pfam:PROCN	395	801	2.9e-239	PFAM
low complexity region	802	814	N/A	INTRINSIC
Pfam:RRM_4	986	1077	1.5e-51	PFAM
Pfam:U5_2-snRNA_bdg	1210	1343	1.1e-77	PFAM
Pfam:U6-snRNA_bdg	1442	1600	4.2e-97	PFAM
Pfam:PRP8_domainIV	1760	1989	9.8e-134	PFAM
JAB_MPN	2099	2233	9.02e-30	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000131283

SMART Domains

Protein: ENSMUSP00000115635
Gene: ENSMUSG00000020850

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	92	1.9e-13	PFAM
Pfam:PRO8NT	90	154	2.5e-30	PFAM
low complexity region	314	333	N/A	INTRINSIC
Pfam:PROCN	338	746	1.7e-226	PFAM
low complexity region	747	759	N/A	INTRINSIC
Pfam:RRM_4	931	1024	5.3e-49	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (45/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either heterozygous or homozygous for a knock-in allele exhibit abnormal retinal pigment epithelium morphology and late-onset retinal degeneration. These changes are more severe in homozygous mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029H14Rik	A	T	8: 13,608,643 (GRCm39)	D145E	possibly damaging	Het
Adcy7	T	C	8: 89,037,697 (GRCm39)	L255P	probably damaging	Het
Cbx7	A	T	15: 79,818,099 (GRCm39)	V1D	unknown	Het
Cd209c	A	C	8: 3,995,700 (GRCm39)	M34R	probably benign	Het
Chodl	A	T	16: 78,743,601 (GRCm39)	L229F	probably damaging	Het
Depdc5	C	A	5: 33,053,252 (GRCm39)	N197K	possibly damaging	Het
Dnai1	T	A	4: 41,614,258 (GRCm39)	D311E	probably damaging	Het
Dop1a	A	G	9: 86,400,392 (GRCm39)	Y1017C	probably benign	Het
Dop1b	T	A	16: 93,562,336 (GRCm39)	L927*	probably null	Het
Dpp10	A	G	1: 123,280,389 (GRCm39)	S646P	probably benign	Het
Ebf1	G	A	11: 44,511,374 (GRCm39)	V90M	probably benign	Het
Efhd1	C	T	1: 87,192,313 (GRCm39)	P48S	probably benign	Het
Fam83b	T	C	9: 76,398,380 (GRCm39)	T908A	probably benign	Het
Fbxl16	G	A	17: 26,036,957 (GRCm39)	V313I	probably damaging	Het
Git2	C	T	5: 114,904,579 (GRCm39)	M113I	probably damaging	Het
Gpr87	T	A	3: 59,087,308 (GRCm39)	I66F	probably damaging	Het
H60c	A	C	10: 3,209,338 (GRCm39)	L217V	unknown	Het
Iba57	T	C	11: 59,054,086 (GRCm39)		probably benign	Het
Igkv11-125	C	A	6: 67,890,814 (GRCm39)	T44N	probably benign	Het
Itih2	T	A	2: 10,128,294 (GRCm39)	I136F	probably damaging	Het
Itpr3	T	A	17: 27,329,836 (GRCm39)	D1543E	probably benign	Het
Myl10	G	C	5: 136,726,825 (GRCm39)	V70L	probably benign	Het
Mylk	A	T	16: 34,792,389 (GRCm39)	E1570V	probably benign	Het
N4bp2	T	A	5: 65,964,639 (GRCm39)	L896H	probably damaging	Het
Ndc1	T	A	4: 107,247,595 (GRCm39)	S468T	probably benign	Het
Ndst3	T	C	3: 123,395,094 (GRCm39)	N512S	probably damaging	Het
Or51b6	A	G	7: 103,555,610 (GRCm39)		probably benign	Het
Or5w15	T	A	2: 87,568,147 (GRCm39)	I174F	probably damaging	Het
Plekhn1	T	C	4: 156,312,697 (GRCm39)	I54V	possibly damaging	Het
Polr3c	T	C	3: 96,622,968 (GRCm39)	E350G	probably null	Het
Pum1	T	C	4: 130,478,836 (GRCm39)	V486A	possibly damaging	Het
Rin2	T	G	2: 145,702,977 (GRCm39)	S558A	probably damaging	Het
Ripk4	A	T	16: 97,564,737 (GRCm39)	V58D	probably damaging	Het
Smyd3	A	G	1: 179,238,028 (GRCm39)	M113T	possibly damaging	Het
Spock1	A	T	13: 57,843,984 (GRCm39)		probably null	Het
Srgap3	C	T	6: 112,716,325 (GRCm39)	R625H	probably benign	Het
Tasor2	C	T	13: 3,619,602 (GRCm39)	V2210I	probably benign	Het
Tmed2	T	C	5: 124,684,986 (GRCm39)	I134T	possibly damaging	Het
Washc2	T	A	6: 116,201,464 (GRCm39)	S353R	probably damaging	Het
Xdh	T	A	17: 74,207,652 (GRCm39)	R902W	probably benign	Het
Zbtb5	A	T	4: 44,994,972 (GRCm39)	S137R	probably benign	Het
Zfp286	A	T	11: 62,644,345 (GRCm39)	I192K	unknown	Het
Zfp942	T	C	17: 22,149,391 (GRCm39)	Y38C	probably damaging	Het
Zfpm1	T	C	8: 123,062,323 (GRCm39)	S461P	probably benign	Het

Other mutations in Prpf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01375:Prpf8	APN	11	75,385,121 (GRCm39)	missense	possibly damaging	0.94
IGL01376:Prpf8	APN	11	75,385,121 (GRCm39)	missense	possibly damaging	0.94
IGL01393:Prpf8	APN	11	75,385,121 (GRCm39)	missense	possibly damaging	0.94
IGL01395:Prpf8	APN	11	75,385,121 (GRCm39)	missense	possibly damaging	0.94
IGL01554:Prpf8	APN	11	75,386,472 (GRCm39)	missense	probably damaging	1.00
IGL01560:Prpf8	APN	11	75,381,232 (GRCm39)	missense	possibly damaging	0.55
IGL01886:Prpf8	APN	11	75,386,570 (GRCm39)	missense	probably benign	0.32
IGL01946:Prpf8	APN	11	75,390,818 (GRCm39)	missense	probably damaging	1.00
IGL02022:Prpf8	APN	11	75,392,660 (GRCm39)	nonsense	probably null
IGL02077:Prpf8	APN	11	75,386,635 (GRCm39)	missense	probably damaging	0.96
IGL02141:Prpf8	APN	11	75,381,498 (GRCm39)	missense	possibly damaging	0.68
IGL02455:Prpf8	APN	11	75,400,084 (GRCm39)	missense	probably benign	0.32
cutter	UTSW	11	75,386,252 (GRCm39)	splice site	probably null
BB009:Prpf8	UTSW	11	75,383,423 (GRCm39)	missense	possibly damaging	0.92
BB019:Prpf8	UTSW	11	75,383,423 (GRCm39)	missense	possibly damaging	0.92
PIT4514001:Prpf8	UTSW	11	75,387,181 (GRCm39)	missense	possibly damaging	0.53
R0254:Prpf8	UTSW	11	75,397,188 (GRCm39)	missense	possibly damaging	0.93
R0270:Prpf8	UTSW	11	75,396,075 (GRCm39)	missense	probably damaging	0.99
R0504:Prpf8	UTSW	11	75,392,768 (GRCm39)	splice site	probably benign
R0573:Prpf8	UTSW	11	75,381,480 (GRCm39)	missense	probably damaging	1.00
R0613:Prpf8	UTSW	11	75,394,270 (GRCm39)	missense	probably damaging	1.00
R0893:Prpf8	UTSW	11	75,384,775 (GRCm39)	missense	probably damaging	1.00
R0967:Prpf8	UTSW	11	75,385,256 (GRCm39)	missense	probably damaging	1.00
R0975:Prpf8	UTSW	11	75,399,500 (GRCm39)	unclassified	probably benign
R1123:Prpf8	UTSW	11	75,386,111 (GRCm39)	missense	probably damaging	1.00
R1183:Prpf8	UTSW	11	75,381,156 (GRCm39)	missense	possibly damaging	0.95
R1857:Prpf8	UTSW	11	75,386,249 (GRCm39)	critical splice donor site	probably null
R1901:Prpf8	UTSW	11	75,395,570 (GRCm39)	missense	probably damaging	0.99
R1950:Prpf8	UTSW	11	75,387,337 (GRCm39)	missense	possibly damaging	0.72
R2116:Prpf8	UTSW	11	75,378,547 (GRCm39)	missense	possibly damaging	0.51
R2147:Prpf8	UTSW	11	75,381,357 (GRCm39)	missense	probably benign
R2185:Prpf8	UTSW	11	75,377,939 (GRCm39)	nonsense	probably null
R2271:Prpf8	UTSW	11	75,386,189 (GRCm39)	missense	probably damaging	1.00
R2272:Prpf8	UTSW	11	75,386,189 (GRCm39)	missense	probably damaging	1.00
R2898:Prpf8	UTSW	11	75,386,860 (GRCm39)	missense	probably benign	0.00
R3744:Prpf8	UTSW	11	75,397,547 (GRCm39)	splice site	probably null
R3893:Prpf8	UTSW	11	75,391,083 (GRCm39)	missense	possibly damaging	0.73
R4400:Prpf8	UTSW	11	75,381,528 (GRCm39)	missense	possibly damaging	0.63
R4510:Prpf8	UTSW	11	75,382,652 (GRCm39)	missense	probably damaging	0.96
R4511:Prpf8	UTSW	11	75,382,652 (GRCm39)	missense	probably damaging	0.96
R4784:Prpf8	UTSW	11	75,383,331 (GRCm39)	missense	probably damaging	1.00
R5089:Prpf8	UTSW	11	75,400,054 (GRCm39)	splice site	probably null
R5186:Prpf8	UTSW	11	75,380,609 (GRCm39)	missense	possibly damaging	0.93
R5215:Prpf8	UTSW	11	75,391,030 (GRCm39)	missense	probably benign	0.02
R5288:Prpf8	UTSW	11	75,386,625 (GRCm39)	missense	probably damaging	1.00
R5362:Prpf8	UTSW	11	75,397,236 (GRCm39)	missense	possibly damaging	0.53
R5384:Prpf8	UTSW	11	75,386,625 (GRCm39)	missense	probably damaging	1.00
R5386:Prpf8	UTSW	11	75,386,625 (GRCm39)	missense	probably damaging	1.00
R5423:Prpf8	UTSW	11	75,399,784 (GRCm39)	missense	probably damaging	1.00
R5472:Prpf8	UTSW	11	75,394,469 (GRCm39)	missense	possibly damaging	0.89
R5539:Prpf8	UTSW	11	75,394,464 (GRCm39)	missense	probably benign	0.20
R5620:Prpf8	UTSW	11	75,395,927 (GRCm39)	missense	possibly damaging	0.95
R5669:Prpf8	UTSW	11	75,395,564 (GRCm39)	missense	probably damaging	1.00
R5887:Prpf8	UTSW	11	75,391,734 (GRCm39)	missense	possibly damaging	0.87
R5948:Prpf8	UTSW	11	75,400,015 (GRCm39)	missense	possibly damaging	0.95
R6073:Prpf8	UTSW	11	75,384,848 (GRCm39)	critical splice donor site	probably null
R6250:Prpf8	UTSW	11	75,384,334 (GRCm39)	missense	possibly damaging	0.95
R6358:Prpf8	UTSW	11	75,382,321 (GRCm39)	missense	probably benign	0.33
R6629:Prpf8	UTSW	11	75,386,252 (GRCm39)	splice site	probably null
R6804:Prpf8	UTSW	11	75,390,635 (GRCm39)	missense	possibly damaging	0.71
R6922:Prpf8	UTSW	11	75,381,562 (GRCm39)	missense	probably damaging	1.00
R7035:Prpf8	UTSW	11	75,395,654 (GRCm39)	missense	possibly damaging	0.72
R7038:Prpf8	UTSW	11	75,386,984 (GRCm39)	missense	probably benign	0.02
R7089:Prpf8	UTSW	11	75,399,374 (GRCm39)	missense	probably damaging	0.99
R7101:Prpf8	UTSW	11	75,381,226 (GRCm39)	missense	possibly damaging	0.85
R7114:Prpf8	UTSW	11	75,394,181 (GRCm39)	nonsense	probably null
R7182:Prpf8	UTSW	11	75,381,553 (GRCm39)	missense	possibly damaging	0.96
R7290:Prpf8	UTSW	11	75,384,783 (GRCm39)	missense	possibly damaging	0.85
R7323:Prpf8	UTSW	11	75,382,610 (GRCm39)	missense	probably benign	0.32
R7485:Prpf8	UTSW	11	75,399,738 (GRCm39)	nonsense	probably null
R7522:Prpf8	UTSW	11	75,400,102 (GRCm39)	missense	possibly damaging	0.82
R7546:Prpf8	UTSW	11	75,399,200 (GRCm39)	missense	probably damaging	1.00
R7596:Prpf8	UTSW	11	75,382,330 (GRCm39)	missense	probably benign	0.03
R7699:Prpf8	UTSW	11	75,391,022 (GRCm39)	missense	probably benign	0.02
R7731:Prpf8	UTSW	11	75,399,732 (GRCm39)	missense	probably damaging	0.97
R7821:Prpf8	UTSW	11	75,385,300 (GRCm39)	missense	probably benign	0.01
R7932:Prpf8	UTSW	11	75,383,423 (GRCm39)	missense	possibly damaging	0.92
R8039:Prpf8	UTSW	11	75,393,368 (GRCm39)	missense	possibly damaging	0.95
R8316:Prpf8	UTSW	11	75,390,641 (GRCm39)	missense	possibly damaging	0.71
R8560:Prpf8	UTSW	11	75,382,600 (GRCm39)	nonsense	probably null
R8823:Prpf8	UTSW	11	75,384,282 (GRCm39)	missense	probably benign	0.05
R8977:Prpf8	UTSW	11	75,386,870 (GRCm39)	missense	probably benign	0.12
R9116:Prpf8	UTSW	11	75,380,589 (GRCm39)	missense	possibly damaging	0.71
R9166:Prpf8	UTSW	11	75,387,340 (GRCm39)	missense	possibly damaging	0.53
R9360:Prpf8	UTSW	11	75,381,156 (GRCm39)	missense	possibly damaging	0.95
R9453:Prpf8	UTSW	11	75,397,212 (GRCm39)	missense	possibly damaging	0.56
R9518:Prpf8	UTSW	11	75,394,486 (GRCm39)	missense	possibly damaging	0.72
R9532:Prpf8	UTSW	11	75,385,608 (GRCm39)	missense	probably benign	0.01
R9626:Prpf8	UTSW	11	75,385,681 (GRCm39)	missense	possibly damaging	0.53
R9760:Prpf8	UTSW	11	75,394,257 (GRCm39)	missense	probably benign	0.20
X0028:Prpf8	UTSW	11	75,397,590 (GRCm39)	missense	probably damaging	0.99
Z1177:Prpf8	UTSW	11	75,394,160 (GRCm39)	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- AACTCCAAGATGCCTAGCCG -3'
(R):5'- CCCACCTGTTCTGAGCAATAGC -3'

Sequencing Primer
(F):5'- GTATTCTACACCCCTAAGGAGCTGG -3'
(R):5'- GAGCAATAGCCTCTTGTCTCTTGAG -3'

Posted On

2020-01-23