Incidental Mutation 'R8067:Tasor2'
ID 620072
Institutional Source Beutler Lab
Gene Symbol Tasor2
Ensembl Gene ENSMUSG00000033799
Gene Name transcription activation suppressor family member 2
Synonyms BC016423, Fam208b
MMRRC Submission 067502-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.102) question?
Stock # R8067 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 3616035-3661108 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 3619602 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 2210 (V2210I)
Ref Sequence ENSEMBL: ENSMUSP00000093774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059515] [ENSMUST00000096069] [ENSMUST00000223396]
AlphaFold Q5DTT3
Predicted Effect probably benign
Transcript: ENSMUST00000059515
SMART Domains Protein: ENSMUSP00000062996
Gene: ENSMUSG00000021218

DomainStartEndE-ValueType
Pfam:GDI 1 436 4.6e-239 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096069
AA Change: V2210I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093774
Gene: ENSMUSG00000033799
AA Change: V2210I

DomainStartEndE-ValueType
Pfam:DUF3699 91 167 1.4e-24 PFAM
low complexity region 272 282 N/A INTRINSIC
low complexity region 447 459 N/A INTRINSIC
Pfam:DUF3715 533 695 2.3e-25 PFAM
low complexity region 1156 1168 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 2012 2021 N/A INTRINSIC
low complexity region 2250 2263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221581
Predicted Effect probably damaging
Transcript: ENSMUST00000222909
AA Change: V1528I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000223396
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik A T 8: 13,608,643 (GRCm39) D145E possibly damaging Het
Adcy7 T C 8: 89,037,697 (GRCm39) L255P probably damaging Het
Cbx7 A T 15: 79,818,099 (GRCm39) V1D unknown Het
Cd209c A C 8: 3,995,700 (GRCm39) M34R probably benign Het
Chodl A T 16: 78,743,601 (GRCm39) L229F probably damaging Het
Depdc5 C A 5: 33,053,252 (GRCm39) N197K possibly damaging Het
Dnai1 T A 4: 41,614,258 (GRCm39) D311E probably damaging Het
Dop1a A G 9: 86,400,392 (GRCm39) Y1017C probably benign Het
Dop1b T A 16: 93,562,336 (GRCm39) L927* probably null Het
Dpp10 A G 1: 123,280,389 (GRCm39) S646P probably benign Het
Ebf1 G A 11: 44,511,374 (GRCm39) V90M probably benign Het
Efhd1 C T 1: 87,192,313 (GRCm39) P48S probably benign Het
Fam83b T C 9: 76,398,380 (GRCm39) T908A probably benign Het
Fbxl16 G A 17: 26,036,957 (GRCm39) V313I probably damaging Het
Git2 C T 5: 114,904,579 (GRCm39) M113I probably damaging Het
Gpr87 T A 3: 59,087,308 (GRCm39) I66F probably damaging Het
H60c A C 10: 3,209,338 (GRCm39) L217V unknown Het
Iba57 T C 11: 59,054,086 (GRCm39) probably benign Het
Igkv11-125 C A 6: 67,890,814 (GRCm39) T44N probably benign Het
Itih2 T A 2: 10,128,294 (GRCm39) I136F probably damaging Het
Itpr3 T A 17: 27,329,836 (GRCm39) D1543E probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Mylk A T 16: 34,792,389 (GRCm39) E1570V probably benign Het
N4bp2 T A 5: 65,964,639 (GRCm39) L896H probably damaging Het
Ndc1 T A 4: 107,247,595 (GRCm39) S468T probably benign Het
Ndst3 T C 3: 123,395,094 (GRCm39) N512S probably damaging Het
Or51b6 A G 7: 103,555,610 (GRCm39) probably benign Het
Or5w15 T A 2: 87,568,147 (GRCm39) I174F probably damaging Het
Plekhn1 T C 4: 156,312,697 (GRCm39) I54V possibly damaging Het
Polr3c T C 3: 96,622,968 (GRCm39) E350G probably null Het
Prpf8 T C 11: 75,390,976 (GRCm39) W1342R probably damaging Het
Pum1 T C 4: 130,478,836 (GRCm39) V486A possibly damaging Het
Rin2 T G 2: 145,702,977 (GRCm39) S558A probably damaging Het
Ripk4 A T 16: 97,564,737 (GRCm39) V58D probably damaging Het
Smyd3 A G 1: 179,238,028 (GRCm39) M113T possibly damaging Het
Spock1 A T 13: 57,843,984 (GRCm39) probably null Het
Srgap3 C T 6: 112,716,325 (GRCm39) R625H probably benign Het
Tmed2 T C 5: 124,684,986 (GRCm39) I134T possibly damaging Het
Washc2 T A 6: 116,201,464 (GRCm39) S353R probably damaging Het
Xdh T A 17: 74,207,652 (GRCm39) R902W probably benign Het
Zbtb5 A T 4: 44,994,972 (GRCm39) S137R probably benign Het
Zfp286 A T 11: 62,644,345 (GRCm39) I192K unknown Het
Zfp942 T C 17: 22,149,391 (GRCm39) Y38C probably damaging Het
Zfpm1 T C 8: 123,062,323 (GRCm39) S461P probably benign Het
Other mutations in Tasor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Tasor2 APN 13 3,624,832 (GRCm39) missense probably benign
IGL00670:Tasor2 APN 13 3,635,241 (GRCm39) missense probably benign 0.14
IGL00957:Tasor2 APN 13 3,627,101 (GRCm39) missense possibly damaging 0.86
IGL01311:Tasor2 APN 13 3,625,885 (GRCm39) missense possibly damaging 0.85
IGL01318:Tasor2 APN 13 3,625,067 (GRCm39) missense possibly damaging 0.66
IGL01767:Tasor2 APN 13 3,626,633 (GRCm39) missense probably benign 0.00
IGL02073:Tasor2 APN 13 3,624,721 (GRCm39) missense probably benign 0.01
IGL02152:Tasor2 APN 13 3,635,371 (GRCm39) missense probably benign
IGL02431:Tasor2 APN 13 3,624,736 (GRCm39) missense possibly damaging 0.85
IGL02478:Tasor2 APN 13 3,624,661 (GRCm39) missense probably benign 0.12
IGL02732:Tasor2 APN 13 3,623,626 (GRCm39) missense probably benign 0.09
IGL02745:Tasor2 APN 13 3,635,140 (GRCm39) missense probably benign 0.23
IGL02800:Tasor2 APN 13 3,635,154 (GRCm39) missense probably benign
IGL02989:Tasor2 APN 13 3,634,820 (GRCm39) missense probably benign 0.01
IGL03124:Tasor2 APN 13 3,624,704 (GRCm39) missense probably benign 0.41
IGL03154:Tasor2 APN 13 3,625,255 (GRCm39) missense possibly damaging 0.56
IGL03216:Tasor2 APN 13 3,624,553 (GRCm39) missense probably damaging 0.98
BB001:Tasor2 UTSW 13 3,644,331 (GRCm39) missense possibly damaging 0.92
BB011:Tasor2 UTSW 13 3,644,331 (GRCm39) missense possibly damaging 0.92
H8562:Tasor2 UTSW 13 3,627,000 (GRCm39) missense probably damaging 0.98
PIT4585001:Tasor2 UTSW 13 3,624,979 (GRCm39) missense possibly damaging 0.55
R0016:Tasor2 UTSW 13 3,635,170 (GRCm39) splice site probably null
R0016:Tasor2 UTSW 13 3,635,170 (GRCm39) splice site probably null
R0157:Tasor2 UTSW 13 3,625,550 (GRCm39) missense probably benign 0.06
R0375:Tasor2 UTSW 13 3,646,842 (GRCm39) missense possibly damaging 0.85
R0403:Tasor2 UTSW 13 3,632,052 (GRCm39) nonsense probably null
R0472:Tasor2 UTSW 13 3,638,364 (GRCm39) missense possibly damaging 0.93
R0517:Tasor2 UTSW 13 3,616,964 (GRCm39) missense possibly damaging 0.94
R0586:Tasor2 UTSW 13 3,640,321 (GRCm39) missense probably damaging 0.99
R0600:Tasor2 UTSW 13 3,626,054 (GRCm39) missense probably benign
R0659:Tasor2 UTSW 13 3,624,448 (GRCm39) missense probably damaging 0.99
R1257:Tasor2 UTSW 13 3,625,049 (GRCm39) missense probably benign 0.25
R1375:Tasor2 UTSW 13 3,626,029 (GRCm39) missense probably benign 0.06
R1443:Tasor2 UTSW 13 3,625,543 (GRCm39) missense probably benign 0.00
R1497:Tasor2 UTSW 13 3,620,409 (GRCm39) missense probably damaging 0.96
R1544:Tasor2 UTSW 13 3,640,413 (GRCm39) missense possibly damaging 0.68
R1554:Tasor2 UTSW 13 3,626,374 (GRCm39) missense possibly damaging 0.85
R1629:Tasor2 UTSW 13 3,624,121 (GRCm39) missense possibly damaging 0.84
R1633:Tasor2 UTSW 13 3,631,771 (GRCm39) missense possibly damaging 0.53
R1661:Tasor2 UTSW 13 3,623,860 (GRCm39) missense possibly damaging 0.63
R1673:Tasor2 UTSW 13 3,634,498 (GRCm39) critical splice donor site probably null
R1675:Tasor2 UTSW 13 3,619,507 (GRCm39) missense possibly damaging 0.65
R1781:Tasor2 UTSW 13 3,634,759 (GRCm39) missense possibly damaging 0.95
R1792:Tasor2 UTSW 13 3,640,559 (GRCm39) missense possibly damaging 0.91
R1826:Tasor2 UTSW 13 3,631,759 (GRCm39) missense probably damaging 0.98
R1920:Tasor2 UTSW 13 3,626,612 (GRCm39) missense possibly damaging 0.63
R1983:Tasor2 UTSW 13 3,624,853 (GRCm39) missense possibly damaging 0.92
R2016:Tasor2 UTSW 13 3,626,770 (GRCm39) missense probably benign 0.41
R2017:Tasor2 UTSW 13 3,626,770 (GRCm39) missense probably benign 0.41
R2220:Tasor2 UTSW 13 3,631,872 (GRCm39) missense probably benign 0.00
R2513:Tasor2 UTSW 13 3,632,150 (GRCm39) missense possibly damaging 0.53
R2898:Tasor2 UTSW 13 3,635,122 (GRCm39) missense possibly damaging 0.82
R2904:Tasor2 UTSW 13 3,632,185 (GRCm39) missense possibly damaging 0.53
R3149:Tasor2 UTSW 13 3,624,359 (GRCm39) missense probably damaging 0.98
R3623:Tasor2 UTSW 13 3,645,556 (GRCm39) missense probably benign
R3624:Tasor2 UTSW 13 3,645,556 (GRCm39) missense probably benign
R3725:Tasor2 UTSW 13 3,640,538 (GRCm39) missense probably benign 0.33
R3835:Tasor2 UTSW 13 3,625,292 (GRCm39) missense probably benign 0.01
R3890:Tasor2 UTSW 13 3,646,785 (GRCm39) missense probably damaging 0.96
R4023:Tasor2 UTSW 13 3,634,554 (GRCm39) missense probably damaging 0.99
R4024:Tasor2 UTSW 13 3,634,554 (GRCm39) missense probably damaging 0.99
R4025:Tasor2 UTSW 13 3,634,554 (GRCm39) missense probably damaging 0.99
R4050:Tasor2 UTSW 13 3,623,507 (GRCm39) missense probably benign 0.09
R4308:Tasor2 UTSW 13 3,619,498 (GRCm39) missense probably damaging 0.97
R4484:Tasor2 UTSW 13 3,631,831 (GRCm39) missense probably benign 0.12
R4674:Tasor2 UTSW 13 3,623,686 (GRCm39) missense possibly damaging 0.69
R4718:Tasor2 UTSW 13 3,624,495 (GRCm39) missense probably benign 0.00
R4745:Tasor2 UTSW 13 3,640,069 (GRCm39) missense probably benign 0.26
R4776:Tasor2 UTSW 13 3,620,391 (GRCm39) missense probably damaging 1.00
R4839:Tasor2 UTSW 13 3,634,807 (GRCm39) missense probably damaging 0.96
R4855:Tasor2 UTSW 13 3,616,680 (GRCm39) splice site probably null
R5049:Tasor2 UTSW 13 3,624,000 (GRCm39) missense probably benign 0.00
R5076:Tasor2 UTSW 13 3,626,357 (GRCm39) missense probably benign 0.41
R5287:Tasor2 UTSW 13 3,625,744 (GRCm39) missense probably benign 0.41
R5298:Tasor2 UTSW 13 3,645,613 (GRCm39) splice site probably null
R5379:Tasor2 UTSW 13 3,638,496 (GRCm39) missense probably benign 0.41
R5512:Tasor2 UTSW 13 3,645,517 (GRCm39) missense probably damaging 0.99
R5624:Tasor2 UTSW 13 3,634,996 (GRCm39) missense possibly damaging 0.66
R5750:Tasor2 UTSW 13 3,623,642 (GRCm39) nonsense probably null
R6114:Tasor2 UTSW 13 3,640,081 (GRCm39) missense probably damaging 1.00
R6118:Tasor2 UTSW 13 3,631,891 (GRCm39) missense possibly damaging 0.76
R6119:Tasor2 UTSW 13 3,631,891 (GRCm39) missense possibly damaging 0.76
R6269:Tasor2 UTSW 13 3,631,891 (GRCm39) missense possibly damaging 0.76
R6270:Tasor2 UTSW 13 3,631,891 (GRCm39) missense possibly damaging 0.76
R6271:Tasor2 UTSW 13 3,631,891 (GRCm39) missense possibly damaging 0.76
R6272:Tasor2 UTSW 13 3,631,891 (GRCm39) missense possibly damaging 0.76
R6525:Tasor2 UTSW 13 3,626,540 (GRCm39) nonsense probably null
R6550:Tasor2 UTSW 13 3,640,519 (GRCm39) missense possibly damaging 0.85
R6714:Tasor2 UTSW 13 3,644,189 (GRCm39) missense probably benign 0.00
R6797:Tasor2 UTSW 13 3,626,769 (GRCm39) missense probably benign 0.26
R6967:Tasor2 UTSW 13 3,624,819 (GRCm39) missense probably benign 0.22
R7016:Tasor2 UTSW 13 3,626,857 (GRCm39) missense possibly damaging 0.92
R7219:Tasor2 UTSW 13 3,640,521 (GRCm39) missense probably damaging 0.99
R7454:Tasor2 UTSW 13 3,635,332 (GRCm39) missense probably benign 0.21
R7570:Tasor2 UTSW 13 3,623,621 (GRCm39) missense probably damaging 0.99
R7571:Tasor2 UTSW 13 3,625,292 (GRCm39) missense probably benign 0.01
R7580:Tasor2 UTSW 13 3,624,752 (GRCm39) missense probably damaging 0.99
R7587:Tasor2 UTSW 13 3,618,849 (GRCm39) missense possibly damaging 0.83
R7657:Tasor2 UTSW 13 3,623,777 (GRCm39) missense probably damaging 0.98
R7810:Tasor2 UTSW 13 3,625,714 (GRCm39) missense possibly damaging 0.61
R7909:Tasor2 UTSW 13 3,623,765 (GRCm39) missense possibly damaging 0.93
R7924:Tasor2 UTSW 13 3,644,331 (GRCm39) missense possibly damaging 0.92
R7945:Tasor2 UTSW 13 3,626,085 (GRCm39) missense probably benign
R8005:Tasor2 UTSW 13 3,625,681 (GRCm39) missense probably benign
R8112:Tasor2 UTSW 13 3,619,516 (GRCm39) missense probably damaging 1.00
R8162:Tasor2 UTSW 13 3,649,691 (GRCm39) missense probably damaging 0.96
R8170:Tasor2 UTSW 13 3,624,881 (GRCm39) nonsense probably null
R8240:Tasor2 UTSW 13 3,624,388 (GRCm39) missense probably benign
R8263:Tasor2 UTSW 13 3,640,016 (GRCm39) missense probably benign 0.03
R8263:Tasor2 UTSW 13 3,625,286 (GRCm39) missense possibly damaging 0.70
R8477:Tasor2 UTSW 13 3,625,079 (GRCm39) missense probably benign 0.18
R9022:Tasor2 UTSW 13 3,626,659 (GRCm39) missense probably benign
R9140:Tasor2 UTSW 13 3,638,441 (GRCm39) missense probably benign 0.04
R9167:Tasor2 UTSW 13 3,624,724 (GRCm39) missense probably benign
R9527:Tasor2 UTSW 13 3,635,191 (GRCm39) missense possibly damaging 0.61
R9535:Tasor2 UTSW 13 3,623,559 (GRCm39) missense possibly damaging 0.69
R9711:Tasor2 UTSW 13 3,649,667 (GRCm39) missense probably benign
X0024:Tasor2 UTSW 13 3,649,837 (GRCm39) missense probably null 0.99
X0025:Tasor2 UTSW 13 3,626,827 (GRCm39) missense probably benign 0.15
X0066:Tasor2 UTSW 13 3,638,441 (GRCm39) missense probably benign 0.04
Z1176:Tasor2 UTSW 13 3,638,429 (GRCm39) missense probably damaging 0.98
Z1176:Tasor2 UTSW 13 3,626,636 (GRCm39) missense probably benign 0.01
Z1177:Tasor2 UTSW 13 3,624,234 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCCCTCAATATACAGTAAGTGATTTC -3'
(R):5'- GGTCAGAACCACTCTTTGTTTCAAAG -3'

Sequencing Primer
(F):5'- GTATGTCACTGGAAGAAGAG -3'
(R):5'- TTCAAAGTTGTCGGTTAGTGATC -3'
Posted On 2020-01-23