Incidental Mutation 'R8068:Pappa2'
ID620086
Institutional Source Beutler Lab
Gene Symbol Pappa2
Ensembl Gene ENSMUSG00000073530
Gene Namepappalysin 2
Synonymspregnancy-associated plasma preproprotein-A2, placenta-specific 3, pregnancy-associated plasma protein-E, PAPP-A2, PLAC3, Pappe
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8068 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location158711727-158980490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 158935985 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 652 (D652G)
Ref Sequence ENSEMBL: ENSMUSP00000124022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159861]
Predicted Effect possibly damaging
Transcript: ENSMUST00000159861
AA Change: D652G

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124022
Gene: ENSMUSG00000073530
AA Change: D652G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Laminin_G_3 271 440 1.2e-25 PFAM
NL 572 614 2.81e-5 SMART
Pfam:Peptidase_M43 669 832 1.5e-12 PFAM
Blast:FN3 844 1103 1e-169 BLAST
low complexity region 1130 1139 N/A INTRINSIC
low complexity region 1361 1370 N/A INTRINSIC
CCP 1394 1457 4.97e0 SMART
CCP 1462 1519 4.81e-1 SMART
CCP 1523 1588 2.58e-4 SMART
CCP 1593 1644 1.13e0 SMART
NL 1720 1757 2.66e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pappalysin family of metzincin metalloproteinases. The encoded protein cleaves insulin-like growth factor-binding protein 5 and is thought to be a local regulator of insulin-like growth factor (IGF) bioavailability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile but display postnatal growth retardation that is more pronounced in females compared to males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T A 8: 40,825,938 D455E not run Het
Aldoc T C 11: 78,324,727 F79S possibly damaging Het
Atmin A G 8: 116,956,650 S350G probably benign Het
Bms1 A G 6: 118,413,750 F206S probably damaging Het
Carmil1 T A 13: 24,075,728 I698L probably benign Het
Cd47 T A 16: 49,895,416 S182T Het
Ces2e G T 8: 104,932,997 probably null Het
Cit C A 5: 115,952,466 H906Q probably damaging Het
Cit T C 5: 115,982,235 S1370P probably benign Het
Dchs2 T C 3: 83,300,438 F1739L probably benign Het
Dlx4 T C 11: 95,145,330 Y51C possibly damaging Het
Drosha T A 15: 12,883,190 Y796* probably null Het
Elf1 T A 14: 79,536,390 F14I probably benign Het
Fam135b T C 15: 71,532,978 Q73R probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gls2 C G 10: 128,195,114 R81G unknown Het
Hnrnpll T C 17: 80,050,852 M157V possibly damaging Het
Itgb3 T A 11: 104,665,511 M726K probably benign Het
Kcna10 T G 3: 107,194,410 M119R possibly damaging Het
Kcnh1 A G 1: 192,241,942 T155A probably benign Het
Kctd9 T A 14: 67,724,662 D51E unknown Het
Lgr6 T C 1: 135,063,664 I129V probably benign Het
Lrrfip1 A T 1: 91,128,102 D598V probably damaging Het
Ltbp4 G T 7: 27,324,168 Q850K probably damaging Het
Mdm1 A G 10: 118,146,804 R115G possibly damaging Het
Mns1 A C 9: 72,448,527 probably null Het
Mthfs G A 9: 89,211,235 R14Q probably damaging Het
Muc2 T A 7: 141,744,685 S25T Het
Ncapd3 T C 9: 27,063,361 S710P possibly damaging Het
Nrip1 T A 16: 76,292,953 H572L possibly damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1020 A G 2: 85,849,806 E118G probably damaging Het
Olfr1152 A G 2: 87,868,651 Y220C probably benign Het
Olfr656 T A 7: 104,618,253 C191* probably null Het
Opa3 A G 7: 19,244,985 E125G probably damaging Het
P3h1 A G 4: 119,236,862 Y238C probably damaging Het
Pcdha11 T A 18: 37,005,565 N82K probably damaging Het
Pde4b T C 4: 102,596,015 I293T probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Qk T C 17: 10,318,803 D24G possibly damaging Het
Rbpjl A G 2: 164,408,518 K197E possibly damaging Het
Rnf111 A T 9: 70,457,941 S415T probably benign Het
Scyl1 A G 19: 5,760,825 V488A probably damaging Het
Slc1a6 G C 10: 78,812,872 V476L possibly damaging Het
Slc22a17 A T 14: 54,908,908 F84I probably benign Het
Slc22a4 A C 11: 53,997,443 I253S possibly damaging Het
Speer2 T C 16: 69,860,524 H77R possibly damaging Het
Speg T C 1: 75,422,250 S2114P probably damaging Het
Synpo2 T A 3: 123,117,392 R201S possibly damaging Het
Ttpa C A 4: 20,028,419 H225Q probably damaging Het
Vmn1r45 A T 6: 89,933,279 H236Q possibly damaging Het
Vmn2r7 A T 3: 64,716,086 V271D probably benign Het
Wdr66 A G 5: 123,256,166 S373G not run Het
Zfp53 A T 17: 21,509,012 T436S probably benign Het
Other mutations in Pappa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Pappa2 APN 1 158857148 missense probably damaging 1.00
IGL01394:Pappa2 APN 1 158765104 splice site probably benign
IGL01570:Pappa2 APN 1 158814540 nonsense probably null
IGL01618:Pappa2 APN 1 158857378 missense probably damaging 1.00
IGL01717:Pappa2 APN 1 158857132 critical splice donor site probably null
IGL01804:Pappa2 APN 1 158936519 missense probably benign
IGL01904:Pappa2 APN 1 158783941 missense probably damaging 0.99
IGL02116:Pappa2 APN 1 158845125 missense probably benign 0.01
IGL02174:Pappa2 APN 1 158761618 missense probably damaging 1.00
IGL02302:Pappa2 APN 1 158715001 missense probably benign 0.38
IGL02422:Pappa2 APN 1 158936933 missense probably damaging 1.00
IGL02572:Pappa2 APN 1 158851216 missense probably benign
IGL02659:Pappa2 APN 1 158936794 missense probably damaging 0.97
IGL02887:Pappa2 APN 1 158782259 missense probably damaging 1.00
IGL02981:Pappa2 APN 1 158851144 missense probably benign 0.00
IGL03128:Pappa2 APN 1 158936484 missense probably benign 0.16
IGL03142:Pappa2 APN 1 158854931 missense probably damaging 1.00
IGL03270:Pappa2 APN 1 158765067 missense possibly damaging 0.78
Gulliver UTSW 1 158857136 missense probably null 1.00
Lilliputian UTSW 1 158716990 missense probably damaging 1.00
Lilliputian2 UTSW 1 158834918 nonsense probably null
lilliputian3 UTSW 1 158782403 splice site probably null
Pitzel UTSW 1 158956645 missense probably damaging 1.00
R0106:Pappa2 UTSW 1 158714977 missense probably damaging 1.00
R0106:Pappa2 UTSW 1 158714977 missense probably damaging 1.00
R0172:Pappa2 UTSW 1 158854849 critical splice donor site probably null
R0194:Pappa2 UTSW 1 158765101 splice site probably benign
R0418:Pappa2 UTSW 1 158716990 missense probably damaging 1.00
R0421:Pappa2 UTSW 1 158848080 missense probably damaging 1.00
R0441:Pappa2 UTSW 1 158763058 unclassified probably benign
R0602:Pappa2 UTSW 1 158763055 unclassified probably benign
R0630:Pappa2 UTSW 1 158832773 missense probably benign
R0760:Pappa2 UTSW 1 158716961 critical splice donor site probably null
R1146:Pappa2 UTSW 1 158854982 missense probably damaging 1.00
R1146:Pappa2 UTSW 1 158854982 missense probably damaging 1.00
R1243:Pappa2 UTSW 1 158845100 missense probably damaging 1.00
R1413:Pappa2 UTSW 1 158936554 missense probably benign 0.00
R1502:Pappa2 UTSW 1 158957288 missense probably damaging 1.00
R1599:Pappa2 UTSW 1 158857172 missense probably damaging 1.00
R1689:Pappa2 UTSW 1 158957398 missense probably damaging 1.00
R1750:Pappa2 UTSW 1 158763150 nonsense probably null
R1772:Pappa2 UTSW 1 158814368 missense possibly damaging 0.92
R1832:Pappa2 UTSW 1 158857316 missense probably damaging 1.00
R1905:Pappa2 UTSW 1 158803503 splice site probably null
R1914:Pappa2 UTSW 1 158750563 missense probably damaging 0.97
R2013:Pappa2 UTSW 1 158834928 missense probably damaging 1.00
R2037:Pappa2 UTSW 1 158956644 nonsense probably null
R2118:Pappa2 UTSW 1 158857266 missense probably damaging 1.00
R2268:Pappa2 UTSW 1 158857271 missense probably damaging 1.00
R2269:Pappa2 UTSW 1 158857271 missense probably damaging 1.00
R2347:Pappa2 UTSW 1 158765043 missense probably damaging 1.00
R3024:Pappa2 UTSW 1 158936225 missense probably benign 0.00
R3706:Pappa2 UTSW 1 158834918 nonsense probably null
R3707:Pappa2 UTSW 1 158834918 nonsense probably null
R3708:Pappa2 UTSW 1 158834918 nonsense probably null
R4600:Pappa2 UTSW 1 158814445 missense probably damaging 1.00
R4737:Pappa2 UTSW 1 158957012 missense probably benign
R4738:Pappa2 UTSW 1 158957012 missense probably benign
R4739:Pappa2 UTSW 1 158957002 missense probably damaging 0.99
R4739:Pappa2 UTSW 1 158957012 missense probably benign
R4788:Pappa2 UTSW 1 158783917 missense possibly damaging 0.86
R4798:Pappa2 UTSW 1 158857379 missense probably damaging 0.99
R4952:Pappa2 UTSW 1 158857136 missense probably null 1.00
R5121:Pappa2 UTSW 1 158838627 missense probably benign 0.01
R5144:Pappa2 UTSW 1 158957133 missense probably benign 0.03
R5159:Pappa2 UTSW 1 158761619 missense probably damaging 1.00
R5278:Pappa2 UTSW 1 158782403 splice site probably null
R5428:Pappa2 UTSW 1 158814785 missense possibly damaging 0.53
R5452:Pappa2 UTSW 1 158838602 missense probably benign 0.00
R5477:Pappa2 UTSW 1 158956738 missense probably benign 0.00
R5504:Pappa2 UTSW 1 158848045 missense probably benign 0.00
R5852:Pappa2 UTSW 1 158717014 missense probably damaging 1.00
R6003:Pappa2 UTSW 1 158936250 missense probably benign 0.23
R6129:Pappa2 UTSW 1 158714997 nonsense probably null
R6137:Pappa2 UTSW 1 158871543 missense probably damaging 1.00
R6374:Pappa2 UTSW 1 158956645 missense probably damaging 1.00
R6472:Pappa2 UTSW 1 158834799 missense probably damaging 1.00
R6804:Pappa2 UTSW 1 158936868 missense probably benign 0.24
R7020:Pappa2 UTSW 1 158848009 missense probably damaging 0.98
R7051:Pappa2 UTSW 1 158957183 missense unknown
R7082:Pappa2 UTSW 1 158763119 missense possibly damaging 0.65
R7111:Pappa2 UTSW 1 158956526 missense probably benign 0.38
R7213:Pappa2 UTSW 1 158936886 missense possibly damaging 0.93
R7575:Pappa2 UTSW 1 158814530 missense probably damaging 1.00
R7587:Pappa2 UTSW 1 158851131 missense probably damaging 1.00
R7826:Pappa2 UTSW 1 158936440 nonsense probably null
R8007:Pappa2 UTSW 1 158782304 missense probably damaging 0.99
R8050:Pappa2 UTSW 1 158848400 missense probably damaging 1.00
R8063:Pappa2 UTSW 1 158936556 missense possibly damaging 0.79
X0058:Pappa2 UTSW 1 158814397 missense probably null
X0061:Pappa2 UTSW 1 158936618 missense possibly damaging 0.87
Z1176:Pappa2 UTSW 1 158814814 missense probably damaging 1.00
Z1176:Pappa2 UTSW 1 158814816 missense probably damaging 1.00
Z1176:Pappa2 UTSW 1 158956933 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCCCAGTAAAGCCTAGGAG -3'
(R):5'- AATTGTGAGCCCAGCAAGATTG -3'

Sequencing Primer
(F):5'- CCTAGGAGGGAAGTTTCATTTGACC -3'
(R):5'- TTGGCAATGACCACTGTGAC -3'
Posted On2020-01-23