Incidental Mutation 'R8068:Rbpjl'
ID620091
Institutional Source Beutler Lab
Gene Symbol Rbpjl
Ensembl Gene ENSMUSG00000017007
Gene Namerecombination signal binding protein for immunoglobulin kappa J region-like
SynonymsRBP-J kappa-like, Rbpsuhl, RBP-L
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8068 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location164403141-164415448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 164408518 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 197 (K197E)
Ref Sequence ENSEMBL: ENSMUSP00000017151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017151] [ENSMUST00000103103] [ENSMUST00000103104] [ENSMUST00000109358] [ENSMUST00000109359]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017151
AA Change: K197E

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000017151
Gene: ENSMUSG00000017007
AA Change: K197E

DomainStartEndE-ValueType
LAG1_DNAbind 66 204 4.58e-78 SMART
BTD 205 357 1.23e-83 SMART
SCOP:d1a02n1 383 475 3e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103103
SMART Domains Protein: ENSMUSP00000099392
Gene: ENSMUSG00000016995

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 34 209 8.6e-54 SMART
EGF 220 257 1.04e-3 SMART
EGF 261 298 3.43e-4 SMART
EGF 302 339 1.85e0 SMART
EGF 343 380 1.24e-1 SMART
VWA 386 564 6.72e-56 SMART
Matrilin_ccoil 574 621 2.39e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103104
SMART Domains Protein: ENSMUSP00000099393
Gene: ENSMUSG00000016995

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 34 209 8.6e-54 SMART
EGF 220 257 1.04e-3 SMART
EGF 261 298 3.43e-4 SMART
EGF 302 339 1.85e0 SMART
EGF 343 380 1.24e-1 SMART
VWA 386 564 6.72e-56 SMART
Matrilin_ccoil 574 621 2.39e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109358
SMART Domains Protein: ENSMUSP00000104982
Gene: ENSMUSG00000016995

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 34 209 8.6e-54 SMART
EGF 220 257 1.85e0 SMART
EGF 261 298 1.24e-1 SMART
VWA 304 482 6.72e-56 SMART
Matrilin_ccoil 492 539 2.39e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109359
SMART Domains Protein: ENSMUSP00000104983
Gene: ENSMUSG00000016995

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 34 209 8.6e-54 SMART
EGF 220 257 3.43e-4 SMART
EGF 261 298 1.85e0 SMART
EGF 302 339 1.24e-1 SMART
VWA 345 523 6.72e-56 SMART
Matrilin_ccoil 533 580 2.39e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the suppressor of hairless protein family. A similar protein in mouse is a transcription factor that binds to DNA sequences almost identical to that bound by the Notch receptor signaling pathway transcription factor recombining binding protein J. The mouse protein has been shown to activate transcription in concert with Epstein-Barr virus nuclear antigen-2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene do not display any obvious phenotype abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T A 8: 40,825,938 D455E not run Het
Aldoc T C 11: 78,324,727 F79S possibly damaging Het
Atmin A G 8: 116,956,650 S350G probably benign Het
Bms1 A G 6: 118,413,750 F206S probably damaging Het
Carmil1 T A 13: 24,075,728 I698L probably benign Het
Cd47 T A 16: 49,895,416 S182T Het
Ces2e G T 8: 104,932,997 probably null Het
Cit C A 5: 115,952,466 H906Q probably damaging Het
Cit T C 5: 115,982,235 S1370P probably benign Het
Dchs2 T C 3: 83,300,438 F1739L probably benign Het
Dlx4 T C 11: 95,145,330 Y51C possibly damaging Het
Drosha T A 15: 12,883,190 Y796* probably null Het
Elf1 T A 14: 79,536,390 F14I probably benign Het
Fam135b T C 15: 71,532,978 Q73R probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gls2 C G 10: 128,195,114 R81G unknown Het
Hnrnpll T C 17: 80,050,852 M157V possibly damaging Het
Itgb3 T A 11: 104,665,511 M726K probably benign Het
Kcna10 T G 3: 107,194,410 M119R possibly damaging Het
Kcnh1 A G 1: 192,241,942 T155A probably benign Het
Kctd9 T A 14: 67,724,662 D51E unknown Het
Lgr6 T C 1: 135,063,664 I129V probably benign Het
Lrrfip1 A T 1: 91,128,102 D598V probably damaging Het
Ltbp4 G T 7: 27,324,168 Q850K probably damaging Het
Mdm1 A G 10: 118,146,804 R115G possibly damaging Het
Mns1 A C 9: 72,448,527 probably null Het
Mthfs G A 9: 89,211,235 R14Q probably damaging Het
Muc2 T A 7: 141,744,685 S25T Het
Ncapd3 T C 9: 27,063,361 S710P possibly damaging Het
Nrip1 T A 16: 76,292,953 H572L possibly damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1020 A G 2: 85,849,806 E118G probably damaging Het
Olfr1152 A G 2: 87,868,651 Y220C probably benign Het
Olfr656 T A 7: 104,618,253 C191* probably null Het
Opa3 A G 7: 19,244,985 E125G probably damaging Het
P3h1 A G 4: 119,236,862 Y238C probably damaging Het
Pappa2 T C 1: 158,935,985 D652G possibly damaging Het
Pcdha11 T A 18: 37,005,565 N82K probably damaging Het
Pde4b T C 4: 102,596,015 I293T probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Qk T C 17: 10,318,803 D24G possibly damaging Het
Rnf111 A T 9: 70,457,941 S415T probably benign Het
Scyl1 A G 19: 5,760,825 V488A probably damaging Het
Slc1a6 G C 10: 78,812,872 V476L possibly damaging Het
Slc22a17 A T 14: 54,908,908 F84I probably benign Het
Slc22a4 A C 11: 53,997,443 I253S possibly damaging Het
Speer2 T C 16: 69,860,524 H77R possibly damaging Het
Speg T C 1: 75,422,250 S2114P probably damaging Het
Synpo2 T A 3: 123,117,392 R201S possibly damaging Het
Ttpa C A 4: 20,028,419 H225Q probably damaging Het
Vmn1r45 A T 6: 89,933,279 H236Q possibly damaging Het
Vmn2r7 A T 3: 64,716,086 V271D probably benign Het
Wdr66 A G 5: 123,256,166 S373G not run Het
Zfp53 A T 17: 21,509,012 T436S probably benign Het
Other mutations in Rbpjl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Rbpjl APN 2 164407785 missense possibly damaging 0.74
IGL02429:Rbpjl APN 2 164413895 missense possibly damaging 0.80
R2155:Rbpjl UTSW 2 164414423 missense possibly damaging 0.80
R2244:Rbpjl UTSW 2 164403217 intron probably benign
R2344:Rbpjl UTSW 2 164414392 missense probably damaging 0.99
R4721:Rbpjl UTSW 2 164404527 missense probably benign 0.08
R5023:Rbpjl UTSW 2 164410289 missense probably damaging 1.00
R5492:Rbpjl UTSW 2 164414410 frame shift probably null
R5493:Rbpjl UTSW 2 164414410 frame shift probably null
R5494:Rbpjl UTSW 2 164414410 frame shift probably null
R5556:Rbpjl UTSW 2 164408062 missense probably benign 0.01
R5796:Rbpjl UTSW 2 164410248 splice site probably benign
R6164:Rbpjl UTSW 2 164410879 missense probably damaging 1.00
R7609:Rbpjl UTSW 2 164405814 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCTTCCGCTGGCAAAGTTG -3'
(R):5'- TGTCTGAAATCTCTGTGTGCC -3'

Sequencing Primer
(F):5'- CTTCCGCTGGCAAAGTTGAGATAAG -3'
(R):5'- GCCTTTTCTCTTAGTCTAGGCCAG -3'
Posted On2020-01-23