Incidental Mutation 'R8068:Dchs2'
ID620093
Institutional Source Beutler Lab
Gene Symbol Dchs2
Ensembl Gene ENSMUSG00000102692
Gene Namedachsous cadherin related 2
SynonymsLOC229459
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.486) question?
Stock #R8068 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location83127948-83357209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83300438 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1739 (F1739L)
Ref Sequence ENSEMBL: ENSMUSP00000141425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000191829]
Predicted Effect probably benign
Transcript: ENSMUST00000191829
AA Change: F1739L

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000141425
Gene: ENSMUSG00000102692
AA Change: F1739L

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
CA 70 149 1.6e-8 SMART
CA 173 278 1.9e-9 SMART
CA 302 395 2e-33 SMART
CA 423 522 3.2e-7 SMART
CA 546 642 1.1e-29 SMART
CA 666 750 5.6e-22 SMART
CA 774 855 1.5e-8 SMART
CA 876 958 4.2e-19 SMART
CA 982 1060 3e-8 SMART
CA 1067 1168 9.3e-7 SMART
CA 1192 1271 1.1e-28 SMART
CA 1299 1379 4e-16 SMART
CA 1403 1486 6.1e-16 SMART
CA 1510 1596 3.5e-18 SMART
CA 1619 1700 4.4e-27 SMART
CA 1724 1805 6.4e-27 SMART
CA 1828 1909 4.3e-29 SMART
CA 1933 2014 3.4e-27 SMART
CA 2038 2116 4.2e-7 SMART
CA 2139 2218 2.5e-15 SMART
CA 2242 2323 2.1e-34 SMART
CA 2346 2423 3e-24 SMART
CA 2447 2525 2e-17 SMART
CA 2549 2641 9.8e-16 SMART
CA 2665 2745 2.3e-24 SMART
CA 2769 2856 5.9e-19 SMART
CA 2880 2959 1e-3 SMART
transmembrane domain 2973 2995 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T A 8: 40,825,938 D455E not run Het
Aldoc T C 11: 78,324,727 F79S possibly damaging Het
Atmin A G 8: 116,956,650 S350G probably benign Het
Bms1 A G 6: 118,413,750 F206S probably damaging Het
Carmil1 T A 13: 24,075,728 I698L probably benign Het
Cd47 T A 16: 49,895,416 S182T Het
Ces2e G T 8: 104,932,997 probably null Het
Cit T C 5: 115,982,235 S1370P probably benign Het
Cit C A 5: 115,952,466 H906Q probably damaging Het
Dlx4 T C 11: 95,145,330 Y51C possibly damaging Het
Drosha T A 15: 12,883,190 Y796* probably null Het
Elf1 T A 14: 79,536,390 F14I probably benign Het
Fam135b T C 15: 71,532,978 Q73R probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gls2 C G 10: 128,195,114 R81G unknown Het
Hnrnpll T C 17: 80,050,852 M157V possibly damaging Het
Itgb3 T A 11: 104,665,511 M726K probably benign Het
Kcna10 T G 3: 107,194,410 M119R possibly damaging Het
Kcnh1 A G 1: 192,241,942 T155A probably benign Het
Kctd9 T A 14: 67,724,662 D51E unknown Het
Lgr6 T C 1: 135,063,664 I129V probably benign Het
Lrrfip1 A T 1: 91,128,102 D598V probably damaging Het
Ltbp4 G T 7: 27,324,168 Q850K probably damaging Het
Mdm1 A G 10: 118,146,804 R115G possibly damaging Het
Mns1 A C 9: 72,448,527 probably null Het
Mthfs G A 9: 89,211,235 R14Q probably damaging Het
Muc2 T A 7: 141,744,685 S25T Het
Ncapd3 T C 9: 27,063,361 S710P possibly damaging Het
Nrip1 T A 16: 76,292,953 H572L possibly damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1020 A G 2: 85,849,806 E118G probably damaging Het
Olfr1152 A G 2: 87,868,651 Y220C probably benign Het
Olfr656 T A 7: 104,618,253 C191* probably null Het
Opa3 A G 7: 19,244,985 E125G probably damaging Het
P3h1 A G 4: 119,236,862 Y238C probably damaging Het
Pappa2 T C 1: 158,935,985 D652G possibly damaging Het
Pcdha11 T A 18: 37,005,565 N82K probably damaging Het
Pde4b T C 4: 102,596,015 I293T probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Qk T C 17: 10,318,803 D24G possibly damaging Het
Rbpjl A G 2: 164,408,518 K197E possibly damaging Het
Rnf111 A T 9: 70,457,941 S415T probably benign Het
Scyl1 A G 19: 5,760,825 V488A probably damaging Het
Slc1a6 G C 10: 78,812,872 V476L possibly damaging Het
Slc22a17 A T 14: 54,908,908 F84I probably benign Het
Slc22a4 A C 11: 53,997,443 I253S possibly damaging Het
Speer2 T C 16: 69,860,524 H77R possibly damaging Het
Speg T C 1: 75,422,250 S2114P probably damaging Het
Synpo2 T A 3: 123,117,392 R201S possibly damaging Het
Ttpa C A 4: 20,028,419 H225Q probably damaging Het
Vmn1r45 A T 6: 89,933,279 H236Q possibly damaging Het
Vmn2r7 A T 3: 64,716,086 V271D probably benign Het
Wdr66 A G 5: 123,256,166 S373G not run Het
Zfp53 A T 17: 21,509,012 T436S probably benign Het
Other mutations in Dchs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1707:Dchs2 UTSW 3 83127605 unclassified probably benign
R5857:Dchs2 UTSW 3 83270313 missense possibly damaging 0.79
R5897:Dchs2 UTSW 3 83285410 missense possibly damaging 0.95
R5959:Dchs2 UTSW 3 83325418 missense probably benign 0.01
R6007:Dchs2 UTSW 3 83346227 missense probably damaging 0.99
R6054:Dchs2 UTSW 3 83346236 missense probably benign 0.00
R6059:Dchs2 UTSW 3 83355736 missense probably benign 0.06
R6075:Dchs2 UTSW 3 83355061 missense possibly damaging 0.68
R6379:Dchs2 UTSW 3 83355146 missense probably damaging 1.00
R6393:Dchs2 UTSW 3 83129911 missense probably damaging 1.00
R6405:Dchs2 UTSW 3 83354263 missense probably benign 0.01
R6432:Dchs2 UTSW 3 83271118 missense possibly damaging 0.96
R6434:Dchs2 UTSW 3 83269270 missense probably damaging 1.00
R6561:Dchs2 UTSW 3 83129169 missense probably benign 0.04
R6798:Dchs2 UTSW 3 83348286 missense probably damaging 1.00
R6801:Dchs2 UTSW 3 83128534 missense probably benign 0.00
R6855:Dchs2 UTSW 3 83348194 missense probably benign 0.08
R6956:Dchs2 UTSW 3 83353926 missense probably benign 0.00
R7090:Dchs2 UTSW 3 83348274 missense probably benign 0.03
R7249:Dchs2 UTSW 3 83128029 nonsense probably null
R7252:Dchs2 UTSW 3 83325303 missense probably benign 0.04
R7462:Dchs2 UTSW 3 83346155 splice site probably null
R7482:Dchs2 UTSW 3 83248725 missense possibly damaging 0.68
R7487:Dchs2 UTSW 3 83356306 missense probably damaging 0.99
R7529:Dchs2 UTSW 3 83354398 missense possibly damaging 0.89
R7542:Dchs2 UTSW 3 83269284 missense probably benign 0.16
R7544:Dchs2 UTSW 3 83355127 missense probably damaging 1.00
R7547:Dchs2 UTSW 3 83356127 missense probably damaging 0.96
R7587:Dchs2 UTSW 3 83304515 missense probably benign
R7632:Dchs2 UTSW 3 83348050 missense probably benign 0.00
R7694:Dchs2 UTSW 3 83129482 missense probably damaging 1.00
R7701:Dchs2 UTSW 3 83346206 missense possibly damaging 0.83
R7746:Dchs2 UTSW 3 83128057 missense possibly damaging 0.94
R7838:Dchs2 UTSW 3 83304527 missense probably benign 0.01
R7886:Dchs2 UTSW 3 83305085 missense probably damaging 1.00
R7921:Dchs2 UTSW 3 83304527 missense probably benign 0.01
R7969:Dchs2 UTSW 3 83305085 missense probably damaging 1.00
R8055:Dchs2 UTSW 3 83129725 missense probably benign 0.00
RF012:Dchs2 UTSW 3 83355068 missense probably benign 0.03
Z1177:Dchs2 UTSW 3 83271140 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CACGAGGCCTTTATTCCAGAAG -3'
(R):5'- ACGTAAAGGCATCTTACAGAACTC -3'

Sequencing Primer
(F):5'- CGAGGCCTTTATTCCAGAAGAACTG -3'
(R):5'- GAGGATCAGACAAACTTTTCTGGCC -3'
Posted On2020-01-23