Mutagenetix > Incidental Mutation

Incidental Mutation 'R8068:P3h1'

620098

Institutional Source

Beutler Lab

Gene Symbol

P3h1

Ensembl Gene

ENSMUSG00000028641

Gene Name

prolyl 3-hydroxylase 1

Synonyms

Lepre1, Gros1, 2410024C15Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8068 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

119232915-119248975 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119236862 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 238 (Y238C)

Ref Sequence

ENSEMBL: ENSMUSP00000112504 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030393] [ENSMUST00000081606] [ENSMUST00000102662] [ENSMUST00000121111] [ENSMUST00000136278] [ENSMUST00000141112]

AlphaFold

Q3V1T4

Predicted Effect

probably damaging
Transcript: ENSMUST00000030393
AA Change: Y238C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030393
Gene: ENSMUSG00000028641
AA Change: Y238C

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	60	84	N/A	INTRINSIC
low complexity region	117	127	N/A	INTRINSIC
internal_repeat_1	136	213	2.49e-12	PROSPERO
internal_repeat_1	294	369	2.49e-12	PROSPERO
Blast:P4Hc	419	462	2e-14	BLAST
P4Hc	479	687	5.96e-53	SMART
low complexity region	714	725	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000081606
AA Change: Y59C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080312
Gene: ENSMUSG00000028641
AA Change: Y59C

Domain	Start	End	E-Value	Type
SCOP:d1hxia_	80	195	4e-5	SMART
Blast:P4Hc	125	206	2e-11	BLAST
Blast:P4Hc	233	276	1e-14	BLAST
P4Hc	293	501	5.96e-53	SMART
low complexity region	528	539	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102662
AA Change: Y238C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099723
Gene: ENSMUSG00000028641
AA Change: Y238C

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	60	84	N/A	INTRINSIC
low complexity region	117	127	N/A	INTRINSIC
internal_repeat_1	136	213	1.9e-12	PROSPERO
internal_repeat_1	294	369	1.9e-12	PROSPERO
Blast:P4Hc	412	455	2e-14	BLAST
P4Hc	472	680	5.96e-53	SMART
low complexity region	707	718	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000121111
AA Change: Y238C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112504
Gene: ENSMUSG00000028641
AA Change: Y238C

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	60	84	N/A	INTRINSIC
low complexity region	117	127	N/A	INTRINSIC
internal_repeat_1	136	213	2.32e-12	PROSPERO
internal_repeat_1	294	369	2.32e-12	PROSPERO
Blast:P4Hc	412	455	2e-14	BLAST
P4Hc	472	680	5.96e-53	SMART
low complexity region	707	718	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000136278
AA Change: Y238C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119695
Gene: ENSMUSG00000028641
AA Change: Y238C

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	60	84	N/A	INTRINSIC
low complexity region	117	127	N/A	INTRINSIC
internal_repeat_1	136	198	6.76e-13	PROSPERO
internal_repeat_1	294	356	6.76e-13	PROSPERO

Predicted Effect

probably benign
Transcript: ENSMUST00000141112

SMART Domains

Protein: ENSMUSP00000115729
Gene: ENSMUSG00000078584

Domain	Start	End	E-Value	Type
Pfam:DUF2452	27	182	2.2e-78	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that is a member of the collagen prolyl hydroxylase family. These enzymes are localized to the endoplasmic reticulum and their activity is required for proper collagen synthesis and assembly. Mutations in this gene are associated with osteogenesis imperfecta type VIII. Three alternatively spliced transcript variants encoding different isoforms have been described. Other variants may exist, but their biological validity has not been determined. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced size, disproportional reduction in long bone length, decreased bone density, decreased bone mineral density, reduced body fat, delayed ossification, and abnormal collagen networks in the skin and tendons. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam39	T	A	8: 40,825,938	D455E	not run	Het
Aldoc	T	C	11: 78,324,727	F79S	possibly damaging	Het
Atmin	A	G	8: 116,956,650	S350G	probably benign	Het
Bms1	A	G	6: 118,413,750	F206S	probably damaging	Het
Carmil1	T	A	13: 24,075,728	I698L	probably benign	Het
Cd47	T	A	16: 49,895,416	S182T		Het
Ces2e	G	T	8: 104,932,997		probably null	Het
Cit	C	A	5: 115,952,466	H906Q	probably damaging	Het
Cit	T	C	5: 115,982,235	S1370P	probably benign	Het
Dchs2	T	C	3: 83,300,438	F1739L	probably benign	Het
Dlx4	T	C	11: 95,145,330	Y51C	possibly damaging	Het
Drosha	T	A	15: 12,883,190	Y796*	probably null	Het
Elf1	T	A	14: 79,536,390	F14I	probably benign	Het
Fam135b	T	C	15: 71,532,978	Q73R	probably damaging	Het
Gatad1	T	C	5: 3,643,540	R210G	probably benign	Het
Gls2	C	G	10: 128,195,114	R81G	unknown	Het
Hnrnpll	T	C	17: 80,050,852	M157V	possibly damaging	Het
Itgb3	T	A	11: 104,665,511	M726K	probably benign	Het
Kcna10	T	G	3: 107,194,410	M119R	possibly damaging	Het
Kcnh1	A	G	1: 192,241,942	T155A	probably benign	Het
Kctd9	T	A	14: 67,724,662	D51E	unknown	Het
Lgr6	T	C	1: 135,063,664	I129V	probably benign	Het
Lrrfip1	A	T	1: 91,128,102	D598V	probably damaging	Het
Ltbp4	G	T	7: 27,324,168	Q850K	probably damaging	Het
Mdm1	A	G	10: 118,146,804	R115G	possibly damaging	Het
Mns1	A	C	9: 72,448,527		probably null	Het
Mthfs	G	A	9: 89,211,235	R14Q	probably damaging	Het
Muc2	T	A	7: 141,744,685	S25T		Het
Ncapd3	T	C	9: 27,063,361	S710P	possibly damaging	Het
Nrip1	T	A	16: 76,292,953	H572L	possibly damaging	Het
Nrp2	C	T	1: 62,745,408	R239C	probably damaging	Het
Olfr1020	A	G	2: 85,849,806	E118G	probably damaging	Het
Olfr1152	A	G	2: 87,868,651	Y220C	probably benign	Het
Olfr656	T	A	7: 104,618,253	C191*	probably null	Het
Opa3	A	G	7: 19,244,985	E125G	probably damaging	Het
Pappa2	T	C	1: 158,935,985	D652G	possibly damaging	Het
Pcdha11	T	A	18: 37,005,565	N82K	probably damaging	Het
Pde4b	T	C	4: 102,596,015	I293T	probably damaging	Het
Prrc2c	TTGCTGCTGCTGCTGCTGCTGCTGCTGC	TTGCTGCTGCTGCTGCTGCTGCTGC	1: 162,709,061		probably benign	Het
Qk	T	C	17: 10,318,803	D24G	possibly damaging	Het
Rbpjl	A	G	2: 164,408,518	K197E	possibly damaging	Het
Rnf111	A	T	9: 70,457,941	S415T	probably benign	Het
Scyl1	A	G	19: 5,760,825	V488A	probably damaging	Het
Slc1a6	G	C	10: 78,812,872	V476L	possibly damaging	Het
Slc22a17	A	T	14: 54,908,908	F84I	probably benign	Het
Slc22a4	A	C	11: 53,997,443	I253S	possibly damaging	Het
Speer2	T	C	16: 69,860,524	H77R	possibly damaging	Het
Speg	T	C	1: 75,422,250	S2114P	probably damaging	Het
Synpo2	T	A	3: 123,117,392	R201S	possibly damaging	Het
Ttpa	C	A	4: 20,028,419	H225Q	probably damaging	Het
Vmn1r45	A	T	6: 89,933,279	H236Q	possibly damaging	Het
Vmn2r7	A	T	3: 64,716,086	V271D	probably benign	Het
Wdr66	A	G	5: 123,256,166	S373G	not run	Het
Zfp53	A	T	17: 21,509,012	T436S	probably benign	Het

Other mutations in P3h1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01622:P3h1	APN	4	119235283	missense	probably damaging	1.00
IGL01623:P3h1	APN	4	119235283	missense	probably damaging	1.00
IGL01645:P3h1	APN	4	119236783	missense	probably damaging	1.00
IGL02140:P3h1	APN	4	119237865	missense	probably damaging	1.00
IGL02415:P3h1	APN	4	119247955	missense	probably benign
IGL02543:P3h1	APN	4	119237856	splice site	probably benign
IGL02870:P3h1	APN	4	119247571	missense	probably damaging	1.00
IGL02972:P3h1	APN	4	119247960	missense	possibly damaging	0.75
IGL03067:P3h1	APN	4	119235280	missense	probably damaging	0.99
IGL03077:P3h1	APN	4	119236786	missense	probably damaging	1.00
woohoo	UTSW	4	119241132	nonsense	probably null
R0194:P3h1	UTSW	4	119237952	missense	probably damaging	1.00
R0523:P3h1	UTSW	4	119241530	missense	probably benign	0.32
R0734:P3h1	UTSW	4	119238688	missense	probably damaging	1.00
R0944:P3h1	UTSW	4	119238759	missense	probably benign	0.00
R1018:P3h1	UTSW	4	119237907	missense	probably damaging	0.99
R1978:P3h1	UTSW	4	119247976	missense	probably null	0.00
R2697:P3h1	UTSW	4	119247180	missense	probably damaging	1.00
R5668:P3h1	UTSW	4	119244046	missense	possibly damaging	0.89
R5750:P3h1	UTSW	4	119238666	missense	probably damaging	0.96
R5965:P3h1	UTSW	4	119248227	missense	probably benign	0.00
R5987:P3h1	UTSW	4	119246665	missense	probably damaging	1.00
R6111:P3h1	UTSW	4	119241132	nonsense	probably null
R6786:P3h1	UTSW	4	119237954	missense	possibly damaging	0.65
R7142:P3h1	UTSW	4	119247161	missense	probably benign	0.00
R8304:P3h1	UTSW	4	119247205	missense	probably damaging	1.00
R9502:P3h1	UTSW	4	119236811	missense	possibly damaging	0.86
R9680:P3h1	UTSW	4	119233231	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- TTATGTAGGAGCACCCAGGATC -3'
(R):5'- TGTGCATTGTCAGGACTTTGAC -3'

Sequencing Primer
(F):5'- CTTAGGAATCACCACTTAGGGATC -3'
(R):5'- GACCTTAAAGTCCTCTGAGGC -3'

Posted On

2020-01-23