Incidental Mutation 'R8068:P3h1'
ID620098
Institutional Source Beutler Lab
Gene Symbol P3h1
Ensembl Gene ENSMUSG00000028641
Gene Nameprolyl 3-hydroxylase 1
SynonymsLepre1, Gros1, 2410024C15Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8068 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location119232915-119248975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119236862 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 238 (Y238C)
Ref Sequence ENSEMBL: ENSMUSP00000112504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030393] [ENSMUST00000081606] [ENSMUST00000102662] [ENSMUST00000121111] [ENSMUST00000136278] [ENSMUST00000141112]
Predicted Effect probably damaging
Transcript: ENSMUST00000030393
AA Change: Y238C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030393
Gene: ENSMUSG00000028641
AA Change: Y238C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 60 84 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
internal_repeat_1 136 213 2.49e-12 PROSPERO
internal_repeat_1 294 369 2.49e-12 PROSPERO
Blast:P4Hc 419 462 2e-14 BLAST
P4Hc 479 687 5.96e-53 SMART
low complexity region 714 725 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000081606
AA Change: Y59C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080312
Gene: ENSMUSG00000028641
AA Change: Y59C

DomainStartEndE-ValueType
SCOP:d1hxia_ 80 195 4e-5 SMART
Blast:P4Hc 125 206 2e-11 BLAST
Blast:P4Hc 233 276 1e-14 BLAST
P4Hc 293 501 5.96e-53 SMART
low complexity region 528 539 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102662
AA Change: Y238C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099723
Gene: ENSMUSG00000028641
AA Change: Y238C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 60 84 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
internal_repeat_1 136 213 1.9e-12 PROSPERO
internal_repeat_1 294 369 1.9e-12 PROSPERO
Blast:P4Hc 412 455 2e-14 BLAST
P4Hc 472 680 5.96e-53 SMART
low complexity region 707 718 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121111
AA Change: Y238C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112504
Gene: ENSMUSG00000028641
AA Change: Y238C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 60 84 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
internal_repeat_1 136 213 2.32e-12 PROSPERO
internal_repeat_1 294 369 2.32e-12 PROSPERO
Blast:P4Hc 412 455 2e-14 BLAST
P4Hc 472 680 5.96e-53 SMART
low complexity region 707 718 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136278
AA Change: Y238C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119695
Gene: ENSMUSG00000028641
AA Change: Y238C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 60 84 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
internal_repeat_1 136 198 6.76e-13 PROSPERO
internal_repeat_1 294 356 6.76e-13 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000141112
SMART Domains Protein: ENSMUSP00000115729
Gene: ENSMUSG00000078584

DomainStartEndE-ValueType
Pfam:DUF2452 27 182 2.2e-78 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that is a member of the collagen prolyl hydroxylase family. These enzymes are localized to the endoplasmic reticulum and their activity is required for proper collagen synthesis and assembly. Mutations in this gene are associated with osteogenesis imperfecta type VIII. Three alternatively spliced transcript variants encoding different isoforms have been described. Other variants may exist, but their biological validity has not been determined. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced size, disproportional reduction in long bone length, decreased bone density, decreased bone mineral density, reduced body fat, delayed ossification, and abnormal collagen networks in the skin and tendons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T A 8: 40,825,938 D455E not run Het
Aldoc T C 11: 78,324,727 F79S possibly damaging Het
Atmin A G 8: 116,956,650 S350G probably benign Het
Bms1 A G 6: 118,413,750 F206S probably damaging Het
Carmil1 T A 13: 24,075,728 I698L probably benign Het
Cd47 T A 16: 49,895,416 S182T Het
Ces2e G T 8: 104,932,997 probably null Het
Cit C A 5: 115,952,466 H906Q probably damaging Het
Cit T C 5: 115,982,235 S1370P probably benign Het
Dchs2 T C 3: 83,300,438 F1739L probably benign Het
Dlx4 T C 11: 95,145,330 Y51C possibly damaging Het
Drosha T A 15: 12,883,190 Y796* probably null Het
Elf1 T A 14: 79,536,390 F14I probably benign Het
Fam135b T C 15: 71,532,978 Q73R probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gls2 C G 10: 128,195,114 R81G unknown Het
Hnrnpll T C 17: 80,050,852 M157V possibly damaging Het
Itgb3 T A 11: 104,665,511 M726K probably benign Het
Kcna10 T G 3: 107,194,410 M119R possibly damaging Het
Kcnh1 A G 1: 192,241,942 T155A probably benign Het
Kctd9 T A 14: 67,724,662 D51E unknown Het
Lgr6 T C 1: 135,063,664 I129V probably benign Het
Lrrfip1 A T 1: 91,128,102 D598V probably damaging Het
Ltbp4 G T 7: 27,324,168 Q850K probably damaging Het
Mdm1 A G 10: 118,146,804 R115G possibly damaging Het
Mns1 A C 9: 72,448,527 probably null Het
Mthfs G A 9: 89,211,235 R14Q probably damaging Het
Muc2 T A 7: 141,744,685 S25T Het
Ncapd3 T C 9: 27,063,361 S710P possibly damaging Het
Nrip1 T A 16: 76,292,953 H572L possibly damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1020 A G 2: 85,849,806 E118G probably damaging Het
Olfr1152 A G 2: 87,868,651 Y220C probably benign Het
Olfr656 T A 7: 104,618,253 C191* probably null Het
Opa3 A G 7: 19,244,985 E125G probably damaging Het
Pappa2 T C 1: 158,935,985 D652G possibly damaging Het
Pcdha11 T A 18: 37,005,565 N82K probably damaging Het
Pde4b T C 4: 102,596,015 I293T probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Qk T C 17: 10,318,803 D24G possibly damaging Het
Rbpjl A G 2: 164,408,518 K197E possibly damaging Het
Rnf111 A T 9: 70,457,941 S415T probably benign Het
Scyl1 A G 19: 5,760,825 V488A probably damaging Het
Slc1a6 G C 10: 78,812,872 V476L possibly damaging Het
Slc22a17 A T 14: 54,908,908 F84I probably benign Het
Slc22a4 A C 11: 53,997,443 I253S possibly damaging Het
Speer2 T C 16: 69,860,524 H77R possibly damaging Het
Speg T C 1: 75,422,250 S2114P probably damaging Het
Synpo2 T A 3: 123,117,392 R201S possibly damaging Het
Ttpa C A 4: 20,028,419 H225Q probably damaging Het
Vmn1r45 A T 6: 89,933,279 H236Q possibly damaging Het
Vmn2r7 A T 3: 64,716,086 V271D probably benign Het
Wdr66 A G 5: 123,256,166 S373G not run Het
Zfp53 A T 17: 21,509,012 T436S probably benign Het
Other mutations in P3h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:P3h1 APN 4 119235283 missense probably damaging 1.00
IGL01623:P3h1 APN 4 119235283 missense probably damaging 1.00
IGL01645:P3h1 APN 4 119236783 missense probably damaging 1.00
IGL02140:P3h1 APN 4 119237865 missense probably damaging 1.00
IGL02415:P3h1 APN 4 119247955 missense probably benign
IGL02543:P3h1 APN 4 119237856 splice site probably benign
IGL02870:P3h1 APN 4 119247571 missense probably damaging 1.00
IGL02972:P3h1 APN 4 119247960 missense possibly damaging 0.75
IGL03067:P3h1 APN 4 119235280 missense probably damaging 0.99
IGL03077:P3h1 APN 4 119236786 missense probably damaging 1.00
woohoo UTSW 4 119241132 nonsense probably null
R0194:P3h1 UTSW 4 119237952 missense probably damaging 1.00
R0523:P3h1 UTSW 4 119241530 missense probably benign 0.32
R0734:P3h1 UTSW 4 119238688 missense probably damaging 1.00
R0944:P3h1 UTSW 4 119238759 missense probably benign 0.00
R1018:P3h1 UTSW 4 119237907 missense probably damaging 0.99
R1978:P3h1 UTSW 4 119247976 missense probably null 0.00
R2697:P3h1 UTSW 4 119247180 missense probably damaging 1.00
R5668:P3h1 UTSW 4 119244046 missense possibly damaging 0.89
R5750:P3h1 UTSW 4 119238666 missense probably damaging 0.96
R5965:P3h1 UTSW 4 119248227 missense probably benign 0.00
R5987:P3h1 UTSW 4 119246665 missense probably damaging 1.00
R6111:P3h1 UTSW 4 119241132 nonsense probably null
R6786:P3h1 UTSW 4 119237954 missense possibly damaging 0.65
R7142:P3h1 UTSW 4 119247161 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTATGTAGGAGCACCCAGGATC -3'
(R):5'- TGTGCATTGTCAGGACTTTGAC -3'

Sequencing Primer
(F):5'- CTTAGGAATCACCACTTAGGGATC -3'
(R):5'- GACCTTAAAGTCCTCTGAGGC -3'
Posted On2020-01-23