Incidental Mutation 'R8068:Wdr66'
ID620102
Institutional Source Beutler Lab
Gene Symbol Wdr66
Ensembl Gene ENSMUSG00000029442
Gene NameWD repeat domain 66
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R8068 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location123252102-123327484 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123256166 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 373 (S373G)
Ref Sequence ENSEMBL: ENSMUSP00000113309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121964]
Predicted Effect not run
Transcript: ENSMUST00000121964
AA Change: S373G
SMART Domains Protein: ENSMUSP00000113309
Gene: ENSMUSG00000029442
AA Change: S373G

DomainStartEndE-ValueType
coiled coil region 9 160 N/A INTRINSIC
coiled coil region 243 299 N/A INTRINSIC
WD40 437 478 1.58e-2 SMART
WD40 481 525 6.16e0 SMART
Blast:WD40 532 572 2e-15 BLAST
Blast:WD40 584 623 5e-17 BLAST
low complexity region 627 641 N/A INTRINSIC
WD40 643 677 7.64e1 SMART
Blast:WD40 686 742 1e-13 BLAST
WD40 745 784 8.62e-4 SMART
WD40 789 827 1.19e1 SMART
WD40 832 871 5.97e-1 SMART
WD40 880 923 1.23e2 SMART
WD40 1030 1070 1.15e0 SMART
low complexity region 1274 1285 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member appears to function in the determination of mean platelet volume (MPV), and polymorphisms in this gene have been associated with variance in MPV. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T A 8: 40,825,938 D455E not run Het
Aldoc T C 11: 78,324,727 F79S possibly damaging Het
Atmin A G 8: 116,956,650 S350G probably benign Het
Bms1 A G 6: 118,413,750 F206S probably damaging Het
Carmil1 T A 13: 24,075,728 I698L probably benign Het
Cd47 T A 16: 49,895,416 S182T Het
Ces2e G T 8: 104,932,997 probably null Het
Cit C A 5: 115,952,466 H906Q probably damaging Het
Cit T C 5: 115,982,235 S1370P probably benign Het
Dchs2 T C 3: 83,300,438 F1739L probably benign Het
Dlx4 T C 11: 95,145,330 Y51C possibly damaging Het
Drosha T A 15: 12,883,190 Y796* probably null Het
Elf1 T A 14: 79,536,390 F14I probably benign Het
Fam135b T C 15: 71,532,978 Q73R probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gls2 C G 10: 128,195,114 R81G unknown Het
Hnrnpll T C 17: 80,050,852 M157V possibly damaging Het
Itgb3 T A 11: 104,665,511 M726K probably benign Het
Kcna10 T G 3: 107,194,410 M119R possibly damaging Het
Kcnh1 A G 1: 192,241,942 T155A probably benign Het
Kctd9 T A 14: 67,724,662 D51E unknown Het
Lgr6 T C 1: 135,063,664 I129V probably benign Het
Lrrfip1 A T 1: 91,128,102 D598V probably damaging Het
Ltbp4 G T 7: 27,324,168 Q850K probably damaging Het
Mdm1 A G 10: 118,146,804 R115G possibly damaging Het
Mns1 A C 9: 72,448,527 probably null Het
Mthfs G A 9: 89,211,235 R14Q probably damaging Het
Muc2 T A 7: 141,744,685 S25T Het
Ncapd3 T C 9: 27,063,361 S710P possibly damaging Het
Nrip1 T A 16: 76,292,953 H572L possibly damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1020 A G 2: 85,849,806 E118G probably damaging Het
Olfr1152 A G 2: 87,868,651 Y220C probably benign Het
Olfr656 T A 7: 104,618,253 C191* probably null Het
Opa3 A G 7: 19,244,985 E125G probably damaging Het
P3h1 A G 4: 119,236,862 Y238C probably damaging Het
Pappa2 T C 1: 158,935,985 D652G possibly damaging Het
Pcdha11 T A 18: 37,005,565 N82K probably damaging Het
Pde4b T C 4: 102,596,015 I293T probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Qk T C 17: 10,318,803 D24G possibly damaging Het
Rbpjl A G 2: 164,408,518 K197E possibly damaging Het
Rnf111 A T 9: 70,457,941 S415T probably benign Het
Scyl1 A G 19: 5,760,825 V488A probably damaging Het
Slc1a6 G C 10: 78,812,872 V476L possibly damaging Het
Slc22a17 A T 14: 54,908,908 F84I probably benign Het
Slc22a4 A C 11: 53,997,443 I253S possibly damaging Het
Speer2 T C 16: 69,860,524 H77R possibly damaging Het
Speg T C 1: 75,422,250 S2114P probably damaging Het
Synpo2 T A 3: 123,117,392 R201S possibly damaging Het
Ttpa C A 4: 20,028,419 H225Q probably damaging Het
Vmn1r45 A T 6: 89,933,279 H236Q possibly damaging Het
Vmn2r7 A T 3: 64,716,086 V271D probably benign Het
Zfp53 A T 17: 21,509,012 T436S probably benign Het
Other mutations in Wdr66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Wdr66 APN 5 123274177 missense probably damaging 1.00
IGL01090:Wdr66 APN 5 123279989 splice site probably benign
IGL01387:Wdr66 APN 5 123283546 missense probably damaging 1.00
IGL01432:Wdr66 APN 5 123279952 missense possibly damaging 0.88
IGL01642:Wdr66 APN 5 123288698 missense possibly damaging 0.77
IGL01720:Wdr66 APN 5 123322494 missense probably benign 0.07
IGL02104:Wdr66 APN 5 123302698 nonsense probably null
IGL02160:Wdr66 APN 5 123256018 missense unknown
IGL02238:Wdr66 APN 5 123302423 missense probably damaging 1.00
IGL02820:Wdr66 APN 5 123254636 unclassified probably benign
IGL03183:Wdr66 APN 5 123254619 unclassified probably benign
R0078:Wdr66 UTSW 5 123298570 missense probably benign 0.04
R0207:Wdr66 UTSW 5 123283447 missense probably damaging 0.98
R0411:Wdr66 UTSW 5 123290054 missense probably damaging 1.00
R0414:Wdr66 UTSW 5 123287413 splice site probably null
R0722:Wdr66 UTSW 5 123256185 missense probably damaging 1.00
R1169:Wdr66 UTSW 5 123254610 small deletion probably benign
R1527:Wdr66 UTSW 5 123287345 missense probably benign 0.19
R1924:Wdr66 UTSW 5 123302739 missense possibly damaging 0.67
R2022:Wdr66 UTSW 5 123273790 missense probably benign 0.29
R2110:Wdr66 UTSW 5 123254375 unclassified probably benign
R2112:Wdr66 UTSW 5 123254375 unclassified probably benign
R2147:Wdr66 UTSW 5 123256191 missense probably benign 0.01
R2258:Wdr66 UTSW 5 123283348 splice site probably null
R2407:Wdr66 UTSW 5 123289969 missense probably benign 0.11
R2418:Wdr66 UTSW 5 123254268 unclassified probably benign
R2497:Wdr66 UTSW 5 123283369 missense probably damaging 1.00
R2509:Wdr66 UTSW 5 123256106 missense probably benign 0.00
R3437:Wdr66 UTSW 5 123254372 unclassified probably benign
R3730:Wdr66 UTSW 5 123326568 missense possibly damaging 0.70
R3800:Wdr66 UTSW 5 123254721 unclassified probably benign
R4018:Wdr66 UTSW 5 123322454 missense probably benign 0.04
R4181:Wdr66 UTSW 5 123293810 missense probably benign 0.33
R4302:Wdr66 UTSW 5 123293810 missense probably benign 0.33
R4640:Wdr66 UTSW 5 123302432 missense probably benign 0.00
R4701:Wdr66 UTSW 5 123322613 missense probably benign 0.00
R4799:Wdr66 UTSW 5 123302772 missense probably benign 0.04
R4812:Wdr66 UTSW 5 123287305 missense probably benign 0.01
R4922:Wdr66 UTSW 5 123256053 missense probably benign 0.00
R5123:Wdr66 UTSW 5 123273633 start gained probably benign
R5314:Wdr66 UTSW 5 123322563 missense probably benign 0.01
R5445:Wdr66 UTSW 5 123287177 missense probably damaging 1.00
R5458:Wdr66 UTSW 5 123254445 unclassified probably benign
R5462:Wdr66 UTSW 5 123298632 critical splice donor site probably null
R5514:Wdr66 UTSW 5 123287766 critical splice donor site probably null
R5600:Wdr66 UTSW 5 123288698 missense possibly damaging 0.77
R5635:Wdr66 UTSW 5 123322572 missense probably benign 0.25
R5767:Wdr66 UTSW 5 123298521 missense probably benign 0.01
R5943:Wdr66 UTSW 5 123286357 missense probably benign 0.13
R6000:Wdr66 UTSW 5 123254372 unclassified probably benign
R6030:Wdr66 UTSW 5 123274204 missense probably damaging 0.97
R6030:Wdr66 UTSW 5 123274204 missense probably damaging 0.97
R6293:Wdr66 UTSW 5 123322448 missense probably damaging 1.00
R6354:Wdr66 UTSW 5 123302755 missense probably damaging 0.99
R6356:Wdr66 UTSW 5 123254666 unclassified probably benign
R6427:Wdr66 UTSW 5 123326533 missense probably damaging 1.00
R6896:Wdr66 UTSW 5 123278358 missense possibly damaging 0.81
R6909:Wdr66 UTSW 5 123287752 missense probably damaging 1.00
R7503:Wdr66 UTSW 5 123297458 nonsense probably null
R7707:Wdr66 UTSW 5 123253887 missense probably benign 0.00
R7715:Wdr66 UTSW 5 123262134 missense probably damaging 1.00
R7809:Wdr66 UTSW 5 123264831 missense probably damaging 1.00
R7819:Wdr66 UTSW 5 123254259 unclassified probably benign
R7842:Wdr66 UTSW 5 123254424 missense unknown
R7898:Wdr66 UTSW 5 123322454 missense probably damaging 0.99
R7925:Wdr66 UTSW 5 123254424 missense unknown
R7981:Wdr66 UTSW 5 123322454 missense probably damaging 0.99
R8004:Wdr66 UTSW 5 123254450 missense unknown
RF007:Wdr66 UTSW 5 123254254 small insertion probably benign
RF010:Wdr66 UTSW 5 123274161 critical splice acceptor site probably benign
RF015:Wdr66 UTSW 5 123254242 small insertion probably benign
RF015:Wdr66 UTSW 5 123274161 critical splice acceptor site probably benign
RF017:Wdr66 UTSW 5 123253890 small insertion probably benign
RF024:Wdr66 UTSW 5 123253883 small insertion probably benign
RF024:Wdr66 UTSW 5 123253888 small insertion probably benign
RF024:Wdr66 UTSW 5 123253889 small insertion probably benign
X0062:Wdr66 UTSW 5 123274237 missense probably benign 0.29
X0066:Wdr66 UTSW 5 123288647 missense probably benign 0.05
Predicted Primers
Posted On2020-01-23