Incidental Mutation 'R8068:Vmn1r45'
ID620103
Institutional Source Beutler Lab
Gene Symbol Vmn1r45
Ensembl Gene ENSMUSG00000044248
Gene Namevomeronasal 1 receptor 45
SynonymsV1r2, V1ra2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R8068 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location89931649-89940598 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89933279 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 236 (H236Q)
Ref Sequence ENSEMBL: ENSMUSP00000052123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054202] [ENSMUST00000226167] [ENSMUST00000227122] [ENSMUST00000227426] [ENSMUST00000227571] [ENSMUST00000227977] [ENSMUST00000228492] [ENSMUST00000228662]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054202
AA Change: H236Q

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000052123
Gene: ENSMUSG00000044248
AA Change: H236Q

DomainStartEndE-ValueType
Pfam:TAS2R 26 315 2.5e-10 PFAM
Pfam:V1R 54 318 1.5e-136 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000226167
AA Change: H116Q

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227122
AA Change: H116Q

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227426
AA Change: H236Q

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227571
AA Change: H116Q

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227977
AA Change: H236Q

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228492
AA Change: H116Q

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228662
AA Change: H236Q

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T A 8: 40,825,938 D455E not run Het
Aldoc T C 11: 78,324,727 F79S possibly damaging Het
Atmin A G 8: 116,956,650 S350G probably benign Het
Bms1 A G 6: 118,413,750 F206S probably damaging Het
Carmil1 T A 13: 24,075,728 I698L probably benign Het
Cd47 T A 16: 49,895,416 S182T Het
Ces2e G T 8: 104,932,997 probably null Het
Cit C A 5: 115,952,466 H906Q probably damaging Het
Cit T C 5: 115,982,235 S1370P probably benign Het
Dchs2 T C 3: 83,300,438 F1739L probably benign Het
Dlx4 T C 11: 95,145,330 Y51C possibly damaging Het
Drosha T A 15: 12,883,190 Y796* probably null Het
Elf1 T A 14: 79,536,390 F14I probably benign Het
Fam135b T C 15: 71,532,978 Q73R probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gls2 C G 10: 128,195,114 R81G unknown Het
Hnrnpll T C 17: 80,050,852 M157V possibly damaging Het
Itgb3 T A 11: 104,665,511 M726K probably benign Het
Kcna10 T G 3: 107,194,410 M119R possibly damaging Het
Kcnh1 A G 1: 192,241,942 T155A probably benign Het
Kctd9 T A 14: 67,724,662 D51E unknown Het
Lgr6 T C 1: 135,063,664 I129V probably benign Het
Lrrfip1 A T 1: 91,128,102 D598V probably damaging Het
Ltbp4 G T 7: 27,324,168 Q850K probably damaging Het
Mdm1 A G 10: 118,146,804 R115G possibly damaging Het
Mns1 A C 9: 72,448,527 probably null Het
Mthfs G A 9: 89,211,235 R14Q probably damaging Het
Muc2 T A 7: 141,744,685 S25T Het
Ncapd3 T C 9: 27,063,361 S710P possibly damaging Het
Nrip1 T A 16: 76,292,953 H572L possibly damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1020 A G 2: 85,849,806 E118G probably damaging Het
Olfr1152 A G 2: 87,868,651 Y220C probably benign Het
Olfr656 T A 7: 104,618,253 C191* probably null Het
Opa3 A G 7: 19,244,985 E125G probably damaging Het
P3h1 A G 4: 119,236,862 Y238C probably damaging Het
Pappa2 T C 1: 158,935,985 D652G possibly damaging Het
Pcdha11 T A 18: 37,005,565 N82K probably damaging Het
Pde4b T C 4: 102,596,015 I293T probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Qk T C 17: 10,318,803 D24G possibly damaging Het
Rbpjl A G 2: 164,408,518 K197E possibly damaging Het
Rnf111 A T 9: 70,457,941 S415T probably benign Het
Scyl1 A G 19: 5,760,825 V488A probably damaging Het
Slc1a6 G C 10: 78,812,872 V476L possibly damaging Het
Slc22a17 A T 14: 54,908,908 F84I probably benign Het
Slc22a4 A C 11: 53,997,443 I253S possibly damaging Het
Speer2 T C 16: 69,860,524 H77R possibly damaging Het
Speg T C 1: 75,422,250 S2114P probably damaging Het
Synpo2 T A 3: 123,117,392 R201S possibly damaging Het
Ttpa C A 4: 20,028,419 H225Q probably damaging Het
Vmn2r7 A T 3: 64,716,086 V271D probably benign Het
Wdr66 A G 5: 123,256,166 S373G not run Het
Zfp53 A T 17: 21,509,012 T436S probably benign Het
Other mutations in Vmn1r45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Vmn1r45 APN 6 89933664 missense probably damaging 1.00
IGL02010:Vmn1r45 APN 6 89933686 missense probably damaging 1.00
IGL02124:Vmn1r45 APN 6 89933053 missense probably benign 0.03
IGL02413:Vmn1r45 APN 6 89933521 missense possibly damaging 0.75
R0123:Vmn1r45 UTSW 6 89933510 nonsense probably null
R0225:Vmn1r45 UTSW 6 89933510 nonsense probably null
R1513:Vmn1r45 UTSW 6 89933076 missense probably damaging 0.97
R2154:Vmn1r45 UTSW 6 89933983 missense possibly damaging 0.91
R3082:Vmn1r45 UTSW 6 89933742 missense probably benign 0.03
R3781:Vmn1r45 UTSW 6 89933817 missense probably benign
R4982:Vmn1r45 UTSW 6 89933865 missense probably damaging 0.99
R5086:Vmn1r45 UTSW 6 89933100 missense probably benign 0.06
R5327:Vmn1r45 UTSW 6 89933141 missense possibly damaging 0.79
R5470:Vmn1r45 UTSW 6 89933716 missense probably benign 0.04
R6681:Vmn1r45 UTSW 6 89934003 start gained probably benign
R7046:Vmn1r45 UTSW 6 89933556 missense probably benign 0.00
R7050:Vmn1r45 UTSW 6 89933721 missense probably damaging 0.97
R7171:Vmn1r45 UTSW 6 89933334 missense probably damaging 1.00
R7236:Vmn1r45 UTSW 6 89933151 missense probably benign 0.15
R7401:Vmn1r45 UTSW 6 89933434 missense possibly damaging 0.64
R7417:Vmn1r45 UTSW 6 89933053 missense probably benign 0.03
RF019:Vmn1r45 UTSW 6 89933109 missense probably damaging 0.99
X0026:Vmn1r45 UTSW 6 89933742 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCATAAACACAAAAGGGCTGACTG -3'
(R):5'- CCCCAATTTGACCAGGAATGAC -3'

Sequencing Primer
(F):5'- ACTGTGGCATAGATGTGCATCAC -3'
(R):5'- TTGACCAGGAATGACTTTCTTTATG -3'
Posted On2020-01-23