Incidental Mutation 'R8068:Olfr656'
ID620107
Institutional Source Beutler Lab
Gene Symbol Olfr656
Ensembl Gene ENSMUSG00000073924
Gene Nameolfactory receptor 656
SynonymsGA_x6K02T2PBJ9-7245486-7246451, MOR27-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R8068 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location104613955-104621603 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 104618253 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 191 (C191*)
Ref Sequence ENSEMBL: ENSMUSP00000149625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098172] [ENSMUST00000215575]
Predicted Effect probably null
Transcript: ENSMUST00000098172
AA Change: C199*
SMART Domains Protein: ENSMUSP00000095774
Gene: ENSMUSG00000073924
AA Change: C199*

DomainStartEndE-ValueType
Pfam:7tm_4 41 319 5.2e-105 PFAM
Pfam:7TM_GPCR_Srsx 42 316 1.1e-8 PFAM
Pfam:7tm_1 51 302 4.9e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000215575
AA Change: C191*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T A 8: 40,825,938 D455E not run Het
Aldoc T C 11: 78,324,727 F79S possibly damaging Het
Atmin A G 8: 116,956,650 S350G probably benign Het
Bms1 A G 6: 118,413,750 F206S probably damaging Het
Carmil1 T A 13: 24,075,728 I698L probably benign Het
Cd47 T A 16: 49,895,416 S182T Het
Ces2e G T 8: 104,932,997 probably null Het
Cit C A 5: 115,952,466 H906Q probably damaging Het
Cit T C 5: 115,982,235 S1370P probably benign Het
Dchs2 T C 3: 83,300,438 F1739L probably benign Het
Dlx4 T C 11: 95,145,330 Y51C possibly damaging Het
Drosha T A 15: 12,883,190 Y796* probably null Het
Elf1 T A 14: 79,536,390 F14I probably benign Het
Fam135b T C 15: 71,532,978 Q73R probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gls2 C G 10: 128,195,114 R81G unknown Het
Hnrnpll T C 17: 80,050,852 M157V possibly damaging Het
Itgb3 T A 11: 104,665,511 M726K probably benign Het
Kcna10 T G 3: 107,194,410 M119R possibly damaging Het
Kcnh1 A G 1: 192,241,942 T155A probably benign Het
Kctd9 T A 14: 67,724,662 D51E unknown Het
Lgr6 T C 1: 135,063,664 I129V probably benign Het
Lrrfip1 A T 1: 91,128,102 D598V probably damaging Het
Ltbp4 G T 7: 27,324,168 Q850K probably damaging Het
Mdm1 A G 10: 118,146,804 R115G possibly damaging Het
Mns1 A C 9: 72,448,527 probably null Het
Mthfs G A 9: 89,211,235 R14Q probably damaging Het
Muc2 T A 7: 141,744,685 S25T Het
Ncapd3 T C 9: 27,063,361 S710P possibly damaging Het
Nrip1 T A 16: 76,292,953 H572L possibly damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1020 A G 2: 85,849,806 E118G probably damaging Het
Olfr1152 A G 2: 87,868,651 Y220C probably benign Het
Opa3 A G 7: 19,244,985 E125G probably damaging Het
P3h1 A G 4: 119,236,862 Y238C probably damaging Het
Pappa2 T C 1: 158,935,985 D652G possibly damaging Het
Pcdha11 T A 18: 37,005,565 N82K probably damaging Het
Pde4b T C 4: 102,596,015 I293T probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Qk T C 17: 10,318,803 D24G possibly damaging Het
Rbpjl A G 2: 164,408,518 K197E possibly damaging Het
Rnf111 A T 9: 70,457,941 S415T probably benign Het
Scyl1 A G 19: 5,760,825 V488A probably damaging Het
Slc1a6 G C 10: 78,812,872 V476L possibly damaging Het
Slc22a17 A T 14: 54,908,908 F84I probably benign Het
Slc22a4 A C 11: 53,997,443 I253S possibly damaging Het
Speer2 T C 16: 69,860,524 H77R possibly damaging Het
Speg T C 1: 75,422,250 S2114P probably damaging Het
Synpo2 T A 3: 123,117,392 R201S possibly damaging Het
Ttpa C A 4: 20,028,419 H225Q probably damaging Het
Vmn1r45 A T 6: 89,933,279 H236Q possibly damaging Het
Vmn2r7 A T 3: 64,716,086 V271D probably benign Het
Wdr66 A G 5: 123,256,166 S373G not run Het
Zfp53 A T 17: 21,509,012 T436S probably benign Het
Other mutations in Olfr656
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Olfr656 APN 7 104617721 missense probably damaging 0.98
IGL01908:Olfr656 APN 7 104617699 missense probably damaging 1.00
IGL02695:Olfr656 APN 7 104618471 missense probably damaging 1.00
IGL03055:Olfr656 UTSW 7 104618206 missense probably damaging 1.00
R0128:Olfr656 UTSW 7 104618581 missense probably damaging 1.00
R0184:Olfr656 UTSW 7 104618240 missense probably damaging 1.00
R4674:Olfr656 UTSW 7 104618424 nonsense probably null
R4675:Olfr656 UTSW 7 104618424 nonsense probably null
R4723:Olfr656 UTSW 7 104618489 missense possibly damaging 0.56
R4979:Olfr656 UTSW 7 104618605 missense probably null 0.03
R6273:Olfr656 UTSW 7 104617895 missense probably damaging 1.00
R6359:Olfr656 UTSW 7 104618303 missense probably damaging 1.00
R6582:Olfr656 UTSW 7 104618441 missense probably damaging 1.00
R6750:Olfr656 UTSW 7 104618113 missense probably damaging 0.99
R7426:Olfr656 UTSW 7 104617852 missense probably damaging 1.00
R7786:Olfr656 UTSW 7 104617718 missense probably benign 0.02
X0065:Olfr656 UTSW 7 104617758 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGATGGAGTCCACAGTGC -3'
(R):5'- ATGACACAGACATGGGAGCC -3'

Sequencing Primer
(F):5'- CACAGTGCTGTTGGCCATG -3'
(R):5'- CACAGGTACCTAAGGCTTTGGAC -3'
Posted On2020-01-23