Incidental Mutation 'R8068:Muc2'
ID620108
Institutional Source Beutler Lab
Gene Symbol Muc2
Ensembl Gene ENSMUSG00000025515
Gene Namemucin 2
Synonyms2010015E03Rik
MMRRC Submission
Accession Numbers

Genbank: BC034197; MGI: 1339364

Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R8068 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location141690340-141754693 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141744685 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 25 (S25T)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026590]
Predicted Effect probably benign
Transcript: ENSMUST00000026590
SMART Domains Protein: ENSMUSP00000026590
Gene: ENSMUSG00000025515

DomainStartEndE-ValueType
C8 1 63 1.65e-11 SMART
VWC 120 188 5.48e-2 SMART
VWC 229 293 2.38e-11 SMART
Blast:VWD 299 363 4e-17 BLAST
CT 380 463 3.6e-35 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T A 8: 40,825,938 D455E not run Het
Aldoc T C 11: 78,324,727 F79S possibly damaging Het
Atmin A G 8: 116,956,650 S350G probably benign Het
Bms1 A G 6: 118,413,750 F206S probably damaging Het
Carmil1 T A 13: 24,075,728 I698L probably benign Het
Cd47 T A 16: 49,895,416 S182T Het
Ces2e G T 8: 104,932,997 probably null Het
Cit T C 5: 115,982,235 S1370P probably benign Het
Cit C A 5: 115,952,466 H906Q probably damaging Het
Dchs2 T C 3: 83,300,438 F1739L probably benign Het
Dlx4 T C 11: 95,145,330 Y51C possibly damaging Het
Drosha T A 15: 12,883,190 Y796* probably null Het
Elf1 T A 14: 79,536,390 F14I probably benign Het
Fam135b T C 15: 71,532,978 Q73R probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gls2 C G 10: 128,195,114 R81G unknown Het
Hnrnpll T C 17: 80,050,852 M157V possibly damaging Het
Itgb3 T A 11: 104,665,511 M726K probably benign Het
Kcna10 T G 3: 107,194,410 M119R possibly damaging Het
Kcnh1 A G 1: 192,241,942 T155A probably benign Het
Kctd9 T A 14: 67,724,662 D51E unknown Het
Lgr6 T C 1: 135,063,664 I129V probably benign Het
Lrrfip1 A T 1: 91,128,102 D598V probably damaging Het
Ltbp4 G T 7: 27,324,168 Q850K probably damaging Het
Mdm1 A G 10: 118,146,804 R115G possibly damaging Het
Mns1 A C 9: 72,448,527 probably null Het
Mthfs G A 9: 89,211,235 R14Q probably damaging Het
Ncapd3 T C 9: 27,063,361 S710P possibly damaging Het
Nrip1 T A 16: 76,292,953 H572L possibly damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1020 A G 2: 85,849,806 E118G probably damaging Het
Olfr1152 A G 2: 87,868,651 Y220C probably benign Het
Olfr656 T A 7: 104,618,253 C191* probably null Het
Opa3 A G 7: 19,244,985 E125G probably damaging Het
P3h1 A G 4: 119,236,862 Y238C probably damaging Het
Pappa2 T C 1: 158,935,985 D652G possibly damaging Het
Pcdha11 T A 18: 37,005,565 N82K probably damaging Het
Pde4b T C 4: 102,596,015 I293T probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Qk T C 17: 10,318,803 D24G possibly damaging Het
Rbpjl A G 2: 164,408,518 K197E possibly damaging Het
Rnf111 A T 9: 70,457,941 S415T probably benign Het
Scyl1 A G 19: 5,760,825 V488A probably damaging Het
Slc1a6 G C 10: 78,812,872 V476L possibly damaging Het
Slc22a17 A T 14: 54,908,908 F84I probably benign Het
Slc22a4 A C 11: 53,997,443 I253S possibly damaging Het
Speer2 T C 16: 69,860,524 H77R possibly damaging Het
Speg T C 1: 75,422,250 S2114P probably damaging Het
Synpo2 T A 3: 123,117,392 R201S possibly damaging Het
Ttpa C A 4: 20,028,419 H225Q probably damaging Het
Vmn1r45 A T 6: 89,933,279 H236Q possibly damaging Het
Vmn2r7 A T 3: 64,716,086 V271D probably benign Het
Wdr66 A G 5: 123,256,166 S373G not run Het
Zfp53 A T 17: 21,509,012 T436S probably benign Het
Other mutations in Muc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
Eeyore APN 7 141693356 missense probably benign 0.35
kenny APN 7 nonsense
Winnie APN 7 141699460 missense probably damaging 1.00
IGL01303:Muc2 APN 7 141752395 missense probably benign
IGL01482:Muc2 APN 7 141754060 missense probably damaging 0.96
IGL01875:Muc2 APN 7 141752740 missense probably damaging 0.99
IGL02088:Muc2 APN 7 141751504 missense probably damaging 1.00
IGL02415:Muc2 APN 7 141751872 nonsense probably null
IGL02548:Muc2 APN 7 141751857 missense probably damaging 1.00
IGL02836:Muc2 APN 7 141746713 unclassified probably benign
IGL03196:Muc2 APN 7 141747630 missense probably damaging 0.97
Muskatenwein UTSW 7 141753439 missense unknown
nomoco UTSW 7 141753719 missense probably damaging 1.00
Schlendrian UTSW 7 141695682 missense probably damaging 1.00
Seco UTSW 7 141698733 missense probably damaging 1.00
BB001:Muc2 UTSW 7 141695388 missense probably damaging 1.00
BB011:Muc2 UTSW 7 141695388 missense probably damaging 1.00
E0370:Muc2 UTSW 7 141696355 missense probably damaging 1.00
R0127:Muc2 UTSW 7 141748954 missense probably benign 0.00
R0179:Muc2 UTSW 7 141748971 missense probably damaging 1.00
R0201:Muc2 UTSW 7 141699185 frame shift probably null
R0299:Muc2 UTSW 7 141752729 missense probably damaging 1.00
R0547:Muc2 UTSW 7 141699185 frame shift probably null
R0699:Muc2 UTSW 7 141752300 missense probably damaging 1.00
R0900:Muc2 UTSW 7 141699185 frame shift probably null
R1348:Muc2 UTSW 7 141699185 frame shift probably null
R1466:Muc2 UTSW 7 141748974 missense probably damaging 1.00
R1466:Muc2 UTSW 7 141748974 missense probably damaging 1.00
R1625:Muc2 UTSW 7 141697162 missense probably damaging 1.00
R2010:Muc2 UTSW 7 141700875 missense probably damaging 0.99
R2149:Muc2 UTSW 7 141699185 frame shift probably null
R2163:Muc2 UTSW 7 141699185 frame shift probably null
R3008:Muc2 UTSW 7 141695104 missense possibly damaging 0.93
R3110:Muc2 UTSW 7 141745488 unclassified probably benign
R3112:Muc2 UTSW 7 141745488 unclassified probably benign
R3424:Muc2 UTSW 7 141693352 missense probably damaging 0.99
R3786:Muc2 UTSW 7 141697347 missense probably benign 0.01
R3854:Muc2 UTSW 7 141754344 missense probably damaging 1.00
R3964:Muc2 UTSW 7 141699664 missense probably benign 0.17
R3965:Muc2 UTSW 7 141699664 missense probably benign 0.17
R3966:Muc2 UTSW 7 141699664 missense probably benign 0.17
R3973:Muc2 UTSW 7 141746804 unclassified probably benign
R3974:Muc2 UTSW 7 141746804 unclassified probably benign
R3976:Muc2 UTSW 7 141746804 unclassified probably benign
R4327:Muc2 UTSW 7 141695334 missense probably damaging 0.96
R4694:Muc2 UTSW 7 141752345 missense probably damaging 1.00
R4764:Muc2 UTSW 7 141745608 missense possibly damaging 0.88
R4769:Muc2 UTSW 7 141699691 critical splice donor site probably null
R4798:Muc2 UTSW 7 141754140 missense probably benign 0.01
R4900:Muc2 UTSW 7 141749543 missense probably benign 0.32
R5383:Muc2 UTSW 7 141753719 missense probably damaging 1.00
R5489:Muc2 UTSW 7 141751432 missense probably benign 0.00
R5615:Muc2 UTSW 7 141691203 missense probably damaging 1.00
R5856:Muc2 UTSW 7 141745644 unclassified probably benign
R5919:Muc2 UTSW 7 141694928 missense probably damaging 0.97
R5953:Muc2 UTSW 7 141701382 missense probably damaging 0.96
R5979:Muc2 UTSW 7 141697250 splice site probably null
R5979:Muc2 UTSW 7 141751406 missense probably damaging 0.99
R6175:Muc2 UTSW 7 141696632 missense probably damaging 1.00
R6213:Muc2 UTSW 7 141751414 missense probably damaging 1.00
R6281:Muc2 UTSW 7 141752403 missense probably damaging 1.00
R6321:Muc2 UTSW 7 141700828 missense probably benign 0.28
R6390:Muc2 UTSW 7 141752146 missense probably damaging 0.97
R6485:Muc2 UTSW 7 141746736 unclassified probably benign
R6582:Muc2 UTSW 7 141696698 missense probably benign 0.00
R6683:Muc2 UTSW 7 141751477 missense probably benign 0.38
R6896:Muc2 UTSW 7 141752695 missense possibly damaging 0.48
R6906:Muc2 UTSW 7 141698733 missense probably damaging 1.00
R6924:Muc2 UTSW 7 141697834 missense possibly damaging 0.87
R7040:Muc2 UTSW 7 141751457 missense unknown
R7222:Muc2 UTSW 7 141704209 missense
R7251:Muc2 UTSW 7 141692722 missense possibly damaging 0.91
R7282:Muc2 UTSW 7 141752744 missense
R7315:Muc2 UTSW 7 141690402 missense probably damaging 0.99
R7421:Muc2 UTSW 7 141748126 missense
R7556:Muc2 UTSW 7 141753702 missense
R7651:Muc2 UTSW 7 141704201 missense
R7710:Muc2 UTSW 7 141700883 missense possibly damaging 0.92
R7776:Muc2 UTSW 7 141704393 missense
R7813:Muc2 UTSW 7 141696300 splice site probably null
R7843:Muc2 UTSW 7 141695419 missense probably benign 0.03
R7869:Muc2 UTSW 7 141749734 missense
R7924:Muc2 UTSW 7 141695388 missense probably damaging 1.00
R7993:Muc2 UTSW 7 141754436 missense
R8053:Muc2 UTSW 7 141698332 missense probably benign 0.01
R8099:Muc2 UTSW 7 141745438 splice site probably null
R8192:Muc2 UTSW 7 141751478 missense
R8194:Muc2 UTSW 7 141704252 missense
R8545:Muc2 UTSW 7 141752393 missense unknown
R8701:Muc2 UTSW 7 141695607 missense probably damaging 1.00
Z1176:Muc2 UTSW 7 141746714 missense
Z1177:Muc2 UTSW 7 141744794 missense
Predicted Primers
Posted On2020-01-23