Incidental Mutation 'R8068:Rnf111'
ID620113
Institutional Source Beutler Lab
Gene Symbol Rnf111
Ensembl Gene ENSMUSG00000032217
Gene Namering finger 111
SynonymsArkadia
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8068 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location70425424-70503725 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70457941 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 415 (S415T)
Ref Sequence ENSEMBL: ENSMUSP00000034739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034739] [ENSMUST00000113595] [ENSMUST00000213647] [ENSMUST00000215848]
Predicted Effect probably benign
Transcript: ENSMUST00000034739
AA Change: S415T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034739
Gene: ENSMUSG00000032217
AA Change: S415T

DomainStartEndE-ValueType
Pfam:RNF111_N 18 290 2.5e-112 PFAM
low complexity region 340 355 N/A INTRINSIC
low complexity region 503 518 N/A INTRINSIC
low complexity region 623 632 N/A INTRINSIC
low complexity region 692 707 N/A INTRINSIC
low complexity region 744 758 N/A INTRINSIC
low complexity region 759 776 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
low complexity region 924 935 N/A INTRINSIC
RING 937 977 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113595
AA Change: S415T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109225
Gene: ENSMUSG00000032217
AA Change: S415T

DomainStartEndE-ValueType
Pfam:RNF111_N 18 290 1.8e-97 PFAM
low complexity region 340 355 N/A INTRINSIC
low complexity region 503 518 N/A INTRINSIC
low complexity region 623 632 N/A INTRINSIC
low complexity region 692 707 N/A INTRINSIC
low complexity region 744 758 N/A INTRINSIC
low complexity region 759 776 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
low complexity region 924 935 N/A INTRINSIC
RING 937 977 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213647
AA Change: S415T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000215848
AA Change: S415T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear RING-domain containing E3 ubiquitin ligase. This protein interacts with the transforming growth factor (TGF) -beta/NODAL signaling pathway by promoting the ubiquitination and proteosomal degradation of negative regulators, like SMAD proteins, and thereby enhances TGF-beta target-gene transcription. As a modulator of the nodal signaling cascade, this gene plays a critical role in the induction of mesoderm during embryonic development. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele fail to develop anterior structures and midline with failure to develop anterior endoderm, node and mesendoderm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T A 8: 40,825,938 D455E not run Het
Aldoc T C 11: 78,324,727 F79S possibly damaging Het
Atmin A G 8: 116,956,650 S350G probably benign Het
Bms1 A G 6: 118,413,750 F206S probably damaging Het
Carmil1 T A 13: 24,075,728 I698L probably benign Het
Cd47 T A 16: 49,895,416 S182T Het
Ces2e G T 8: 104,932,997 probably null Het
Cit C A 5: 115,952,466 H906Q probably damaging Het
Cit T C 5: 115,982,235 S1370P probably benign Het
Dchs2 T C 3: 83,300,438 F1739L probably benign Het
Dlx4 T C 11: 95,145,330 Y51C possibly damaging Het
Drosha T A 15: 12,883,190 Y796* probably null Het
Elf1 T A 14: 79,536,390 F14I probably benign Het
Fam135b T C 15: 71,532,978 Q73R probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gls2 C G 10: 128,195,114 R81G unknown Het
Hnrnpll T C 17: 80,050,852 M157V possibly damaging Het
Itgb3 T A 11: 104,665,511 M726K probably benign Het
Kcna10 T G 3: 107,194,410 M119R possibly damaging Het
Kcnh1 A G 1: 192,241,942 T155A probably benign Het
Kctd9 T A 14: 67,724,662 D51E unknown Het
Lgr6 T C 1: 135,063,664 I129V probably benign Het
Lrrfip1 A T 1: 91,128,102 D598V probably damaging Het
Ltbp4 G T 7: 27,324,168 Q850K probably damaging Het
Mdm1 A G 10: 118,146,804 R115G possibly damaging Het
Mns1 A C 9: 72,448,527 probably null Het
Mthfs G A 9: 89,211,235 R14Q probably damaging Het
Muc2 T A 7: 141,744,685 S25T Het
Ncapd3 T C 9: 27,063,361 S710P possibly damaging Het
Nrip1 T A 16: 76,292,953 H572L possibly damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1020 A G 2: 85,849,806 E118G probably damaging Het
Olfr1152 A G 2: 87,868,651 Y220C probably benign Het
Olfr656 T A 7: 104,618,253 C191* probably null Het
Opa3 A G 7: 19,244,985 E125G probably damaging Het
P3h1 A G 4: 119,236,862 Y238C probably damaging Het
Pappa2 T C 1: 158,935,985 D652G possibly damaging Het
Pcdha11 T A 18: 37,005,565 N82K probably damaging Het
Pde4b T C 4: 102,596,015 I293T probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Qk T C 17: 10,318,803 D24G possibly damaging Het
Rbpjl A G 2: 164,408,518 K197E possibly damaging Het
Scyl1 A G 19: 5,760,825 V488A probably damaging Het
Slc1a6 G C 10: 78,812,872 V476L possibly damaging Het
Slc22a17 A T 14: 54,908,908 F84I probably benign Het
Slc22a4 A C 11: 53,997,443 I253S possibly damaging Het
Speer2 T C 16: 69,860,524 H77R possibly damaging Het
Speg T C 1: 75,422,250 S2114P probably damaging Het
Synpo2 T A 3: 123,117,392 R201S possibly damaging Het
Ttpa C A 4: 20,028,419 H225Q probably damaging Het
Vmn1r45 A T 6: 89,933,279 H236Q possibly damaging Het
Vmn2r7 A T 3: 64,716,086 V271D probably benign Het
Wdr66 A G 5: 123,256,166 S373G not run Het
Zfp53 A T 17: 21,509,012 T436S probably benign Het
Other mutations in Rnf111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02473:Rnf111 APN 9 70440858 missense probably damaging 1.00
IGL02567:Rnf111 APN 9 70459005 missense probably damaging 1.00
R0052:Rnf111 UTSW 9 70476389 missense probably benign 0.00
R0245:Rnf111 UTSW 9 70453831 splice site probably benign
R0760:Rnf111 UTSW 9 70429678 missense probably damaging 1.00
R1327:Rnf111 UTSW 9 70453816 missense possibly damaging 0.60
R1778:Rnf111 UTSW 9 70476112 missense probably benign 0.00
R1884:Rnf111 UTSW 9 70476238 missense probably damaging 0.99
R1892:Rnf111 UTSW 9 70476374 missense probably damaging 1.00
R2261:Rnf111 UTSW 9 70476391 missense probably benign
R2762:Rnf111 UTSW 9 70476045 missense possibly damaging 0.82
R3980:Rnf111 UTSW 9 70442325 missense probably damaging 1.00
R4577:Rnf111 UTSW 9 70429584 nonsense probably null
R4631:Rnf111 UTSW 9 70450396 missense probably benign 0.07
R4804:Rnf111 UTSW 9 70430957 missense possibly damaging 0.70
R5153:Rnf111 UTSW 9 70476140 missense probably benign 0.35
R5500:Rnf111 UTSW 9 70476043 missense possibly damaging 0.94
R5546:Rnf111 UTSW 9 70459096 missense probably benign 0.05
R5975:Rnf111 UTSW 9 70429580 missense probably damaging 1.00
R6395:Rnf111 UTSW 9 70476410 missense possibly damaging 0.95
R6482:Rnf111 UTSW 9 70429607 missense probably damaging 1.00
R7056:Rnf111 UTSW 9 70453675 missense possibly damaging 0.60
R7239:Rnf111 UTSW 9 70469373 missense probably damaging 1.00
R7444:Rnf111 UTSW 9 70440843 missense probably damaging 1.00
R7618:Rnf111 UTSW 9 70503332 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AACATGAAGTACCTCACCATGTAAG -3'
(R):5'- GGGAATTCTGAGCCCAACCTATC -3'

Sequencing Primer
(F):5'- GAATACACTCTTGCCAACACTGTG -3'
(R):5'- CTGTGAAATGCTAAATTGATGT -3'
Posted On2020-01-23