Mutagenetix > Incidental Mutations

Incidental Mutation 'R8068:Slc22a4'

620119

Institutional Source

Beutler Lab

Gene Symbol

Slc22a4

Ensembl Gene

ENSMUSG00000020334

Gene Name

solute carrier family 22 (organic cation transporter), member 4

Synonyms

Octn1

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.423) question?

Stock #

R8068 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

53983123-54028090 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 53997443 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 253 (I253S)

Ref Sequence

ENSEMBL: ENSMUSP00000020586 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020586]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020586
AA Change: I253S

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000020586
Gene: ENSMUSG00000020334
AA Change: I253S

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
Pfam:Sugar_tr	60	524	2.7e-30	PFAM
Pfam:MFS_1	139	478	1.7e-23	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. The encoded protein is an organic cation transporter and plasma integral membrane protein containing eleven putative transmembrane domains as well as a nucleotide-binding site motif. Transport by this protein is at least partially ATP-dependent. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete loss of ergothioneine with reduced absorption and increased excretion and increased susceptibility of small intestine to inflammation following ischemia and reperfusion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam39	T	A	8: 40,825,938	D455E	not run	Het
Aldoc	T	C	11: 78,324,727	F79S	possibly damaging	Het
Atmin	A	G	8: 116,956,650	S350G	probably benign	Het
Bms1	A	G	6: 118,413,750	F206S	probably damaging	Het
Carmil1	T	A	13: 24,075,728	I698L	probably benign	Het
Cd47	T	A	16: 49,895,416	S182T		Het
Ces2e	G	T	8: 104,932,997		probably null	Het
Cit	C	A	5: 115,952,466	H906Q	probably damaging	Het
Cit	T	C	5: 115,982,235	S1370P	probably benign	Het
Dchs2	T	C	3: 83,300,438	F1739L	probably benign	Het
Dlx4	T	C	11: 95,145,330	Y51C	possibly damaging	Het
Drosha	T	A	15: 12,883,190	Y796*	probably null	Het
Elf1	T	A	14: 79,536,390	F14I	probably benign	Het
Fam135b	T	C	15: 71,532,978	Q73R	probably damaging	Het
Gatad1	T	C	5: 3,643,540	R210G	probably benign	Het
Gls2	C	G	10: 128,195,114	R81G	unknown	Het
Hnrnpll	T	C	17: 80,050,852	M157V	possibly damaging	Het
Itgb3	T	A	11: 104,665,511	M726K	probably benign	Het
Kcna10	T	G	3: 107,194,410	M119R	possibly damaging	Het
Kcnh1	A	G	1: 192,241,942	T155A	probably benign	Het
Kctd9	T	A	14: 67,724,662	D51E	unknown	Het
Lgr6	T	C	1: 135,063,664	I129V	probably benign	Het
Lrrfip1	A	T	1: 91,128,102	D598V	probably damaging	Het
Ltbp4	G	T	7: 27,324,168	Q850K	probably damaging	Het
Mdm1	A	G	10: 118,146,804	R115G	possibly damaging	Het
Mns1	A	C	9: 72,448,527		probably null	Het
Mthfs	G	A	9: 89,211,235	R14Q	probably damaging	Het
Muc2	T	A	7: 141,744,685	S25T		Het
Ncapd3	T	C	9: 27,063,361	S710P	possibly damaging	Het
Nrip1	T	A	16: 76,292,953	H572L	possibly damaging	Het
Nrp2	C	T	1: 62,745,408	R239C	probably damaging	Het
Olfr1020	A	G	2: 85,849,806	E118G	probably damaging	Het
Olfr1152	A	G	2: 87,868,651	Y220C	probably benign	Het
Olfr656	T	A	7: 104,618,253	C191*	probably null	Het
Opa3	A	G	7: 19,244,985	E125G	probably damaging	Het
P3h1	A	G	4: 119,236,862	Y238C	probably damaging	Het
Pappa2	T	C	1: 158,935,985	D652G	possibly damaging	Het
Pcdha11	T	A	18: 37,005,565	N82K	probably damaging	Het
Pde4b	T	C	4: 102,596,015	I293T	probably damaging	Het
Prrc2c	TTGCTGCTGCTGCTGCTGCTGCTGCTGC	TTGCTGCTGCTGCTGCTGCTGCTGC	1: 162,709,061		probably benign	Het
Qk	T	C	17: 10,318,803	D24G	possibly damaging	Het
Rbpjl	A	G	2: 164,408,518	K197E	possibly damaging	Het
Rnf111	A	T	9: 70,457,941	S415T	probably benign	Het
Scyl1	A	G	19: 5,760,825	V488A	probably damaging	Het
Slc1a6	G	C	10: 78,812,872	V476L	possibly damaging	Het
Slc22a17	A	T	14: 54,908,908	F84I	probably benign	Het
Speer2	T	C	16: 69,860,524	H77R	possibly damaging	Het
Speg	T	C	1: 75,422,250	S2114P	probably damaging	Het
Synpo2	T	A	3: 123,117,392	R201S	possibly damaging	Het
Ttpa	C	A	4: 20,028,419	H225Q	probably damaging	Het
Vmn1r45	A	T	6: 89,933,279	H236Q	possibly damaging	Het
Vmn2r7	A	T	3: 64,716,086	V271D	probably benign	Het
Wdr66	A	G	5: 123,256,166	S373G	not run	Het
Zfp53	A	T	17: 21,509,012	T436S	probably benign	Het

Other mutations in Slc22a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01459:Slc22a4	APN	11	53986477	critical splice donor site	probably null
IGL01723:Slc22a4	APN	11	53988845	missense	probably benign	0.28
IGL01839:Slc22a4	APN	11	53996077	missense	probably damaging	0.98
IGL02022:Slc22a4	APN	11	53983609	unclassified	probably benign
IGL02386:Slc22a4	APN	11	53988772	splice site	probably benign
PIT1430001:Slc22a4	UTSW	11	54027957	missense	probably benign
R0001:Slc22a4	UTSW	11	54028003	start gained	probably benign
R1111:Slc22a4	UTSW	11	54007841	missense	probably benign
R1710:Slc22a4	UTSW	11	54027975	start codon destroyed	probably null	0.99
R2104:Slc22a4	UTSW	11	53983610	unclassified	probably benign
R3081:Slc22a4	UTSW	11	54007789	missense	probably benign	0.38
R3498:Slc22a4	UTSW	11	53992053	missense	probably benign	0.00
R4014:Slc22a4	UTSW	11	53997392	missense	probably benign	0.04
R4658:Slc22a4	UTSW	11	53997510	missense	probably benign	0.05
R4720:Slc22a4	UTSW	11	53988893	missense	probably damaging	1.00
R4727:Slc22a4	UTSW	11	54027651	missense	possibly damaging	0.83
R5894:Slc22a4	UTSW	11	53997515	missense	probably benign	0.04
R5945:Slc22a4	UTSW	11	53996028	missense	probably damaging	1.00
R6295:Slc22a4	UTSW	11	54007808	missense	possibly damaging	0.46
R6848:Slc22a4	UTSW	11	54007789	missense	possibly damaging	0.90
R6899:Slc22a4	UTSW	11	53988913	missense	probably damaging	1.00
R7343:Slc22a4	UTSW	11	53986538	missense	possibly damaging	0.53
R7414:Slc22a4	UTSW	11	53997428	missense	probably benign	0.00
R7806:Slc22a4	UTSW	11	53990650	missense	probably damaging	1.00
Z1177:Slc22a4	UTSW	11	54027718	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGTGCCCAGTCACTGAGATG -3'
(R):5'- ATGGCCTTCCTCTGAAAACAG -3'

Sequencing Primer
(F):5'- CTGGAAGTTTGGAGGCAGC -3'
(R):5'- TGGTAGAGCCCTTGTCAAAC -3'

Posted On

2020-01-23