Incidental Mutation 'R8068:Slc22a4'
ID 620119
Institutional Source Beutler Lab
Gene Symbol Slc22a4
Ensembl Gene ENSMUSG00000020334
Gene Name solute carrier family 22 (organic cation transporter), member 4
Synonyms Octn1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock # R8068 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 53983123-54028090 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 53997443 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 253 (I253S)
Ref Sequence ENSEMBL: ENSMUSP00000020586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020586]
AlphaFold Q9Z306
Predicted Effect possibly damaging
Transcript: ENSMUST00000020586
AA Change: I253S

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020586
Gene: ENSMUSG00000020334
AA Change: I253S

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Sugar_tr 60 524 2.7e-30 PFAM
Pfam:MFS_1 139 478 1.7e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. The encoded protein is an organic cation transporter and plasma integral membrane protein containing eleven putative transmembrane domains as well as a nucleotide-binding site motif. Transport by this protein is at least partially ATP-dependent. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete loss of ergothioneine with reduced absorption and increased excretion and increased susceptibility of small intestine to inflammation following ischemia and reperfusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T A 8: 40,825,938 D455E not run Het
Aldoc T C 11: 78,324,727 F79S possibly damaging Het
Atmin A G 8: 116,956,650 S350G probably benign Het
Bms1 A G 6: 118,413,750 F206S probably damaging Het
Carmil1 T A 13: 24,075,728 I698L probably benign Het
Cd47 T A 16: 49,895,416 S182T Het
Ces2e G T 8: 104,932,997 probably null Het
Cit C A 5: 115,952,466 H906Q probably damaging Het
Cit T C 5: 115,982,235 S1370P probably benign Het
Dchs2 T C 3: 83,300,438 F1739L probably benign Het
Dlx4 T C 11: 95,145,330 Y51C possibly damaging Het
Drosha T A 15: 12,883,190 Y796* probably null Het
Elf1 T A 14: 79,536,390 F14I probably benign Het
Fam135b T C 15: 71,532,978 Q73R probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gls2 C G 10: 128,195,114 R81G unknown Het
Hnrnpll T C 17: 80,050,852 M157V possibly damaging Het
Itgb3 T A 11: 104,665,511 M726K probably benign Het
Kcna10 T G 3: 107,194,410 M119R possibly damaging Het
Kcnh1 A G 1: 192,241,942 T155A probably benign Het
Kctd9 T A 14: 67,724,662 D51E unknown Het
Lgr6 T C 1: 135,063,664 I129V probably benign Het
Lrrfip1 A T 1: 91,128,102 D598V probably damaging Het
Ltbp4 G T 7: 27,324,168 Q850K probably damaging Het
Mdm1 A G 10: 118,146,804 R115G possibly damaging Het
Mns1 A C 9: 72,448,527 probably null Het
Mthfs G A 9: 89,211,235 R14Q probably damaging Het
Muc2 T A 7: 141,744,685 S25T Het
Ncapd3 T C 9: 27,063,361 S710P possibly damaging Het
Nrip1 T A 16: 76,292,953 H572L possibly damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1020 A G 2: 85,849,806 E118G probably damaging Het
Olfr1152 A G 2: 87,868,651 Y220C probably benign Het
Olfr656 T A 7: 104,618,253 C191* probably null Het
Opa3 A G 7: 19,244,985 E125G probably damaging Het
P3h1 A G 4: 119,236,862 Y238C probably damaging Het
Pappa2 T C 1: 158,935,985 D652G possibly damaging Het
Pcdha11 T A 18: 37,005,565 N82K probably damaging Het
Pde4b T C 4: 102,596,015 I293T probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Qk T C 17: 10,318,803 D24G possibly damaging Het
Rbpjl A G 2: 164,408,518 K197E possibly damaging Het
Rnf111 A T 9: 70,457,941 S415T probably benign Het
Scyl1 A G 19: 5,760,825 V488A probably damaging Het
Slc1a6 G C 10: 78,812,872 V476L possibly damaging Het
Slc22a17 A T 14: 54,908,908 F84I probably benign Het
Speer2 T C 16: 69,860,524 H77R possibly damaging Het
Speg T C 1: 75,422,250 S2114P probably damaging Het
Synpo2 T A 3: 123,117,392 R201S possibly damaging Het
Ttpa C A 4: 20,028,419 H225Q probably damaging Het
Vmn1r45 A T 6: 89,933,279 H236Q possibly damaging Het
Vmn2r7 A T 3: 64,716,086 V271D probably benign Het
Wdr66 A G 5: 123,256,166 S373G not run Het
Zfp53 A T 17: 21,509,012 T436S probably benign Het
Other mutations in Slc22a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Slc22a4 APN 11 53986477 critical splice donor site probably null
IGL01723:Slc22a4 APN 11 53988845 missense probably benign 0.28
IGL01839:Slc22a4 APN 11 53996077 missense probably damaging 0.98
IGL02022:Slc22a4 APN 11 53983609 unclassified probably benign
IGL02386:Slc22a4 APN 11 53988772 splice site probably benign
PIT1430001:Slc22a4 UTSW 11 54027957 missense probably benign
R0001:Slc22a4 UTSW 11 54028003 start gained probably benign
R1111:Slc22a4 UTSW 11 54007841 missense probably benign
R1710:Slc22a4 UTSW 11 54027975 start codon destroyed probably null 0.99
R2104:Slc22a4 UTSW 11 53983610 unclassified probably benign
R3081:Slc22a4 UTSW 11 54007789 missense probably benign 0.38
R3498:Slc22a4 UTSW 11 53992053 missense probably benign 0.00
R4014:Slc22a4 UTSW 11 53997392 missense probably benign 0.04
R4658:Slc22a4 UTSW 11 53997510 missense probably benign 0.05
R4720:Slc22a4 UTSW 11 53988893 missense probably damaging 1.00
R4727:Slc22a4 UTSW 11 54027651 missense possibly damaging 0.83
R5894:Slc22a4 UTSW 11 53997515 missense probably benign 0.04
R5945:Slc22a4 UTSW 11 53996028 missense probably damaging 1.00
R6295:Slc22a4 UTSW 11 54007808 missense possibly damaging 0.46
R6848:Slc22a4 UTSW 11 54007789 missense possibly damaging 0.90
R6899:Slc22a4 UTSW 11 53988913 missense probably damaging 1.00
R7343:Slc22a4 UTSW 11 53986538 missense possibly damaging 0.53
R7414:Slc22a4 UTSW 11 53997428 missense probably benign 0.00
R7806:Slc22a4 UTSW 11 53990650 missense probably damaging 1.00
R8087:Slc22a4 UTSW 11 53996061 missense possibly damaging 0.80
R8218:Slc22a4 UTSW 11 53986581 missense probably benign 0.00
R8971:Slc22a4 UTSW 11 53988892 missense probably damaging 0.99
R9008:Slc22a4 UTSW 11 53990838 nonsense probably null
R9296:Slc22a4 UTSW 11 53997391 nonsense probably null
R9484:Slc22a4 UTSW 11 53988947 missense possibly damaging 0.94
R9679:Slc22a4 UTSW 11 53990773 missense probably damaging 1.00
Z1177:Slc22a4 UTSW 11 54027718 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGCCCAGTCACTGAGATG -3'
(R):5'- ATGGCCTTCCTCTGAAAACAG -3'

Sequencing Primer
(F):5'- CTGGAAGTTTGGAGGCAGC -3'
(R):5'- TGGTAGAGCCCTTGTCAAAC -3'
Posted On 2020-01-23