Incidental Mutation 'R8068:Dlx4'
ID620121
Institutional Source Beutler Lab
Gene Symbol Dlx4
Ensembl Gene ENSMUSG00000020871
Gene Namedistal-less homeobox 4
SynonymsDlx7, Dlx-4, DII D
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R8068 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location95140447-95146263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95145330 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 51 (Y51C)
Ref Sequence ENSEMBL: ENSMUSP00000021241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021241]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021241
AA Change: Y51C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021241
Gene: ENSMUSG00000020871
AA Change: Y51C

DomainStartEndE-ValueType
low complexity region 92 104 N/A INTRINSIC
HOX 116 178 1.22e-21 SMART
low complexity region 190 201 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Many vertebrate homeo box-containing genes have been identified on the basis of their sequence similarity with Drosophila developmental genes. Members of the Dlx gene family contain a homeobox that is related to that of Distal-less (Dll), a gene expressed in the head and limbs of the developing fruit fly. The Distal-less (Dlx) family of genes comprises at least 6 different members, DLX1-DLX6. The DLX proteins are postulated to play a role in forebrain and craniofacial development. Three transcript variants have been described for this gene, however, the full length nature of one variant has not been described. Studies of the two splice variants revealed that one encoded isoform functions as a repressor of the beta-globin gene while the other isoform lacks that function. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T A 8: 40,825,938 D455E not run Het
Aldoc T C 11: 78,324,727 F79S possibly damaging Het
Atmin A G 8: 116,956,650 S350G probably benign Het
Bms1 A G 6: 118,413,750 F206S probably damaging Het
Carmil1 T A 13: 24,075,728 I698L probably benign Het
Cd47 T A 16: 49,895,416 S182T Het
Ces2e G T 8: 104,932,997 probably null Het
Cit C A 5: 115,952,466 H906Q probably damaging Het
Cit T C 5: 115,982,235 S1370P probably benign Het
Dchs2 T C 3: 83,300,438 F1739L probably benign Het
Drosha T A 15: 12,883,190 Y796* probably null Het
Elf1 T A 14: 79,536,390 F14I probably benign Het
Fam135b T C 15: 71,532,978 Q73R probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gls2 C G 10: 128,195,114 R81G unknown Het
Hnrnpll T C 17: 80,050,852 M157V possibly damaging Het
Itgb3 T A 11: 104,665,511 M726K probably benign Het
Kcna10 T G 3: 107,194,410 M119R possibly damaging Het
Kcnh1 A G 1: 192,241,942 T155A probably benign Het
Kctd9 T A 14: 67,724,662 D51E unknown Het
Lgr6 T C 1: 135,063,664 I129V probably benign Het
Lrrfip1 A T 1: 91,128,102 D598V probably damaging Het
Ltbp4 G T 7: 27,324,168 Q850K probably damaging Het
Mdm1 A G 10: 118,146,804 R115G possibly damaging Het
Mns1 A C 9: 72,448,527 probably null Het
Mthfs G A 9: 89,211,235 R14Q probably damaging Het
Muc2 T A 7: 141,744,685 S25T Het
Ncapd3 T C 9: 27,063,361 S710P possibly damaging Het
Nrip1 T A 16: 76,292,953 H572L possibly damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1020 A G 2: 85,849,806 E118G probably damaging Het
Olfr1152 A G 2: 87,868,651 Y220C probably benign Het
Olfr656 T A 7: 104,618,253 C191* probably null Het
Opa3 A G 7: 19,244,985 E125G probably damaging Het
P3h1 A G 4: 119,236,862 Y238C probably damaging Het
Pappa2 T C 1: 158,935,985 D652G possibly damaging Het
Pcdha11 T A 18: 37,005,565 N82K probably damaging Het
Pde4b T C 4: 102,596,015 I293T probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Qk T C 17: 10,318,803 D24G possibly damaging Het
Rbpjl A G 2: 164,408,518 K197E possibly damaging Het
Rnf111 A T 9: 70,457,941 S415T probably benign Het
Scyl1 A G 19: 5,760,825 V488A probably damaging Het
Slc1a6 G C 10: 78,812,872 V476L possibly damaging Het
Slc22a17 A T 14: 54,908,908 F84I probably benign Het
Slc22a4 A C 11: 53,997,443 I253S possibly damaging Het
Speer2 T C 16: 69,860,524 H77R possibly damaging Het
Speg T C 1: 75,422,250 S2114P probably damaging Het
Synpo2 T A 3: 123,117,392 R201S possibly damaging Het
Ttpa C A 4: 20,028,419 H225Q probably damaging Het
Vmn1r45 A T 6: 89,933,279 H236Q possibly damaging Het
Vmn2r7 A T 3: 64,716,086 V271D probably benign Het
Wdr66 A G 5: 123,256,166 S373G not run Het
Zfp53 A T 17: 21,509,012 T436S probably benign Het
Other mutations in Dlx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0127:Dlx4 UTSW 11 95141229 missense probably benign 0.08
R0383:Dlx4 UTSW 11 95145435 missense probably benign 0.33
R6408:Dlx4 UTSW 11 95145252 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAATCCCTCTAGTTGCGCG -3'
(R):5'- AGACTTTGAAAGGAGCTGGC -3'

Sequencing Primer
(F):5'- CAGAAGAACGCGAAATTTATGC -3'
(R):5'- ATGACCTAGGCCCTGTGG -3'
Posted On2020-01-23