Incidental Mutation 'R8068:Zfp53'
ID620133
Institutional Source Beutler Lab
Gene Symbol Zfp53
Ensembl Gene ENSMUSG00000057409
Gene Namezinc finger protein 53
SynonymsZfp-53, KRAZ1, Zfp118, zfas8, D030067O06Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R8068 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location21491256-21509764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21509012 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 436 (T436S)
Ref Sequence ENSEMBL: ENSMUSP00000075960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076664]
Predicted Effect probably benign
Transcript: ENSMUST00000076664
AA Change: T436S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000075960
Gene: ENSMUSG00000057409
AA Change: T436S

DomainStartEndE-ValueType
KRAB 54 114 6.06e-23 SMART
ZnF_C2H2 226 248 1.18e-2 SMART
ZnF_C2H2 254 276 1.28e-3 SMART
ZnF_C2H2 282 304 2.65e-5 SMART
ZnF_C2H2 310 332 9.58e-3 SMART
ZnF_C2H2 338 360 2.86e-1 SMART
ZnF_C2H2 366 388 4.24e-4 SMART
ZnF_C2H2 394 416 4.87e-4 SMART
ZnF_C2H2 422 444 3.69e-4 SMART
ZnF_C2H2 450 472 6.23e-2 SMART
ZnF_C2H2 478 500 7.26e-3 SMART
ZnF_C2H2 506 528 1.72e-4 SMART
ZnF_C2H2 534 556 5.14e-3 SMART
ZnF_C2H2 562 584 9.08e-4 SMART
ZnF_C2H2 590 612 3.89e-3 SMART
ZnF_C2H2 618 640 4.87e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous disruption of this locus results in pigmentation abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T A 8: 40,825,938 D455E not run Het
Aldoc T C 11: 78,324,727 F79S possibly damaging Het
Atmin A G 8: 116,956,650 S350G probably benign Het
Bms1 A G 6: 118,413,750 F206S probably damaging Het
Carmil1 T A 13: 24,075,728 I698L probably benign Het
Cd47 T A 16: 49,895,416 S182T Het
Ces2e G T 8: 104,932,997 probably null Het
Cit C A 5: 115,952,466 H906Q probably damaging Het
Cit T C 5: 115,982,235 S1370P probably benign Het
Dchs2 T C 3: 83,300,438 F1739L probably benign Het
Dlx4 T C 11: 95,145,330 Y51C possibly damaging Het
Drosha T A 15: 12,883,190 Y796* probably null Het
Elf1 T A 14: 79,536,390 F14I probably benign Het
Fam135b T C 15: 71,532,978 Q73R probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gls2 C G 10: 128,195,114 R81G unknown Het
Hnrnpll T C 17: 80,050,852 M157V possibly damaging Het
Itgb3 T A 11: 104,665,511 M726K probably benign Het
Kcna10 T G 3: 107,194,410 M119R possibly damaging Het
Kcnh1 A G 1: 192,241,942 T155A probably benign Het
Kctd9 T A 14: 67,724,662 D51E unknown Het
Lgr6 T C 1: 135,063,664 I129V probably benign Het
Lrrfip1 A T 1: 91,128,102 D598V probably damaging Het
Ltbp4 G T 7: 27,324,168 Q850K probably damaging Het
Mdm1 A G 10: 118,146,804 R115G possibly damaging Het
Mns1 A C 9: 72,448,527 probably null Het
Mthfs G A 9: 89,211,235 R14Q probably damaging Het
Muc2 T A 7: 141,744,685 S25T Het
Ncapd3 T C 9: 27,063,361 S710P possibly damaging Het
Nrip1 T A 16: 76,292,953 H572L possibly damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1020 A G 2: 85,849,806 E118G probably damaging Het
Olfr1152 A G 2: 87,868,651 Y220C probably benign Het
Olfr656 T A 7: 104,618,253 C191* probably null Het
Opa3 A G 7: 19,244,985 E125G probably damaging Het
P3h1 A G 4: 119,236,862 Y238C probably damaging Het
Pappa2 T C 1: 158,935,985 D652G possibly damaging Het
Pcdha11 T A 18: 37,005,565 N82K probably damaging Het
Pde4b T C 4: 102,596,015 I293T probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Qk T C 17: 10,318,803 D24G possibly damaging Het
Rbpjl A G 2: 164,408,518 K197E possibly damaging Het
Rnf111 A T 9: 70,457,941 S415T probably benign Het
Scyl1 A G 19: 5,760,825 V488A probably damaging Het
Slc1a6 G C 10: 78,812,872 V476L possibly damaging Het
Slc22a17 A T 14: 54,908,908 F84I probably benign Het
Slc22a4 A C 11: 53,997,443 I253S possibly damaging Het
Speer2 T C 16: 69,860,524 H77R possibly damaging Het
Speg T C 1: 75,422,250 S2114P probably damaging Het
Synpo2 T A 3: 123,117,392 R201S possibly damaging Het
Ttpa C A 4: 20,028,419 H225Q probably damaging Het
Vmn1r45 A T 6: 89,933,279 H236Q possibly damaging Het
Vmn2r7 A T 3: 64,716,086 V271D probably benign Het
Wdr66 A G 5: 123,256,166 S373G not run Het
Other mutations in Zfp53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Zfp53 APN 17 21508338 missense probably benign
IGL00862:Zfp53 APN 17 21509098 missense probably benign 0.04
IGL01651:Zfp53 APN 17 21508086 missense probably benign 0.19
IGL02183:Zfp53 APN 17 21500250 missense possibly damaging 0.51
R0063:Zfp53 UTSW 17 21508105 missense probably benign 0.19
R0449:Zfp53 UTSW 17 21508833 missense probably benign 0.17
R0514:Zfp53 UTSW 17 21509009 missense probably damaging 1.00
R0755:Zfp53 UTSW 17 21508577 missense probably damaging 1.00
R1661:Zfp53 UTSW 17 21509504 missense probably damaging 1.00
R1665:Zfp53 UTSW 17 21509504 missense probably damaging 1.00
R1693:Zfp53 UTSW 17 21509622 missense possibly damaging 0.60
R2113:Zfp53 UTSW 17 21508451 missense probably benign 0.19
R2869:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R2869:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R2870:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R2870:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R2871:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R2871:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R2873:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R2874:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R2908:Zfp53 UTSW 17 21508474 nonsense probably null
R3873:Zfp53 UTSW 17 21508631 missense probably damaging 0.98
R4499:Zfp53 UTSW 17 21509235 missense probably damaging 0.96
R4806:Zfp53 UTSW 17 21505001 missense possibly damaging 0.91
R5007:Zfp53 UTSW 17 21509510 missense probably benign 0.15
R6261:Zfp53 UTSW 17 21508713 missense possibly damaging 0.90
R6329:Zfp53 UTSW 17 21508110 missense probably benign 0.01
R6452:Zfp53 UTSW 17 21509613 missense probably damaging 1.00
R6899:Zfp53 UTSW 17 21508445 missense possibly damaging 0.62
R7033:Zfp53 UTSW 17 21500246 missense probably benign 0.05
R7250:Zfp53 UTSW 17 21509578 missense probably damaging 1.00
Predicted Primers
Posted On2020-01-23