Incidental Mutation 'R8069:AW146154'
ID620166
Institutional Source Beutler Lab
Gene Symbol AW146154
Ensembl Gene ENSMUSG00000074166
Gene Nameexpressed sequence AW146154
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R8069 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location41478874-41499890 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 41480511 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 394 (R394C)
Ref Sequence ENSEMBL: ENSMUSP00000096109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094532] [ENSMUST00000098509]
Predicted Effect probably benign
Transcript: ENSMUST00000094532
Predicted Effect probably benign
Transcript: ENSMUST00000098509
AA Change: R394C

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000096109
Gene: ENSMUSG00000074166
AA Change: R394C

DomainStartEndE-ValueType
KRAB 4 66 9.86e-14 SMART
ZnF_C2H2 75 97 9.08e1 SMART
ZnF_C2H2 131 153 7.78e-3 SMART
ZnF_C2H2 159 181 4.72e-2 SMART
ZnF_C2H2 187 209 3.63e-3 SMART
ZnF_C2H2 215 237 8.47e-4 SMART
ZnF_C2H2 243 265 4.24e-4 SMART
ZnF_C2H2 271 293 5.81e-2 SMART
ZnF_C2H2 299 321 2.61e-4 SMART
ZnF_C2H2 327 349 2.12e-4 SMART
ZnF_C2H2 355 377 1.6e-4 SMART
ZnF_C2H2 383 405 8.47e-4 SMART
ZnF_C2H2 411 433 6.88e-4 SMART
ZnF_C2H2 439 461 1.6e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt T A 9: 4,296,823 D261V probably benign Het
Abca8a T C 11: 110,090,050 Y54C probably damaging Het
Adad2 T C 8: 119,616,007 S431P probably benign Het
Adam18 A G 8: 24,628,230 Y557H possibly damaging Het
Adam5 C T 8: 24,813,525 E129K probably damaging Het
Adgra2 T C 8: 27,119,223 V824A probably benign Het
Armc12 A T 17: 28,532,436 K135* probably null Het
Aup1 C T 6: 83,055,929 Q215* probably null Het
Canx T G 11: 50,311,704 D25A possibly damaging Het
Ccnf A G 17: 24,225,015 L593P probably damaging Het
Cd40 A T 2: 165,056,775 I41F unknown Het
Cdh1 C T 8: 106,657,773 A291V probably benign Het
Cdhr2 A T 13: 54,731,070 I963F probably damaging Het
Cenpe G A 3: 135,243,718 G88D probably damaging Het
Cep295 T A 9: 15,322,586 T2305S possibly damaging Het
Clcn4 T C 7: 7,296,759 R24G probably damaging Het
Cnot7 T C 8: 40,507,473 N98S possibly damaging Het
Defa3 T G 8: 21,288,272 C91G probably damaging Het
Dennd2c T C 3: 103,165,130 F844L probably damaging Het
Dido1 T C 2: 180,660,912 D1733G probably benign Het
Dnah7b G A 1: 46,224,706 W2116* probably null Het
Dnaja3 T C 16: 4,684,267 V45A probably benign Het
Efcab7 T A 4: 99,829,378 S11T unknown Het
Enpp2 T A 15: 54,847,301 K744N probably damaging Het
Fam171b CCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGC 2: 83,812,874 probably benign Het
Fdxacb1 T G 9: 50,768,835 F107C probably damaging Het
Fnbp1 A T 2: 31,036,594 Y433N probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm15446 T A 5: 109,940,440 Y6* probably null Het
Gm45140 T C 6: 87,819,569 H66R Het
Grin3b G A 10: 79,977,034 R981Q unknown Het
Ipp T G 4: 116,510,856 I95M probably benign Het
Iqca A G 1: 90,045,744 F769L probably damaging Het
Jkamp C T 12: 72,090,058 L67F probably damaging Het
Llgl2 T A 11: 115,853,286 M773K probably damaging Het
Man2b1 A G 8: 85,097,045 T973A probably benign Het
Mcm2 T C 6: 88,892,057 Y271C probably damaging Het
Msl2 T C 9: 101,100,960 S178P probably benign Het
Myo7a G T 7: 98,083,626 S648* probably null Het
Neurl1b G T 17: 26,432,227 V158F probably damaging Het
Nkain2 A G 10: 32,890,038 V142A unknown Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Odf3 A T 7: 140,850,302 T201S probably benign Het
Olfr1124 A T 2: 87,435,020 N178Y possibly damaging Het
Olfr259 A G 2: 87,108,067 Y107H probably damaging Het
Oma1 A T 4: 103,319,035 probably benign Het
Plekhg6 T C 6: 125,363,046 T784A probably benign Het
Prtg T C 9: 72,844,983 I217T probably benign Het
Ptx4 T C 17: 25,122,779 F76S probably damaging Het
Rap1b A C 10: 117,821,609 I55S probably damaging Het
Sftpd T C 14: 41,172,581 T294A probably benign Het
Spg11 C T 2: 122,113,156 V172I probably benign Het
Srms T A 2: 181,206,958 H363L probably damaging Het
Tbc1d13 A T 2: 30,147,403 M266L probably damaging Het
Tbc1d2 A C 4: 46,649,737 C100G possibly damaging Het
Tdg A T 10: 82,638,793 Q39L probably benign Het
Tiam1 G A 16: 89,789,258 A1547V probably benign Het
Trpm1 A G 7: 64,208,970 E380G possibly damaging Het
Unc13b T G 4: 43,177,597 D2808E unknown Het
Usp25 A T 16: 77,069,055 D287V possibly damaging Het
Zfp648 A T 1: 154,204,116 Q7L probably benign Het
Zfp931 T C 2: 178,067,916 R226G probably benign Het
Zfyve9 T A 4: 108,685,018 E201D probably benign Het
Other mutations in AW146154
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:AW146154 APN 7 41480459 missense probably damaging 1.00
R1351:AW146154 UTSW 7 41480454 missense probably damaging 1.00
R3763:AW146154 UTSW 7 41480370 missense probably damaging 1.00
R4829:AW146154 UTSW 7 41480633 missense possibly damaging 0.62
R4835:AW146154 UTSW 7 41480468 missense probably damaging 1.00
R5326:AW146154 UTSW 7 41481377 missense probably benign 0.00
R5542:AW146154 UTSW 7 41481377 missense probably benign 0.00
R5976:AW146154 UTSW 7 41480297 missense probably damaging 0.99
R6252:AW146154 UTSW 7 41481387 missense probably benign 0.10
R7006:AW146154 UTSW 7 41481224 missense possibly damaging 0.50
R7053:AW146154 UTSW 7 41482564 critical splice donor site probably null
R7096:AW146154 UTSW 7 41481443 missense probably benign 0.32
R7649:AW146154 UTSW 7 41480732 missense probably benign 0.13
R8085:AW146154 UTSW 7 41481197 missense possibly damaging 0.61
R8085:AW146154 UTSW 7 41481198 missense probably damaging 1.00
R8266:AW146154 UTSW 7 41481168 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCAAAACTACTGTGATATGCAAAGGC -3'
(R):5'- TTTACCCGGCACAATAGTCTC -3'

Sequencing Primer
(F):5'- TCTCTGCAGTATGAATTGGCTC -3'
(R):5'- CGGCACAATAGTCTCCAAATAC -3'
Posted On2020-01-23