Incidental Mutation 'R8069:Adam5'
ID620172
Institutional Source Beutler Lab
Gene Symbol Adam5
Ensembl Gene ENSMUSG00000031554
Gene Namea disintegrin and metallopeptidase domain 5
SynonymstMDCII
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R8069 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location24727093-24824369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24813525 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 129 (E129K)
Ref Sequence ENSEMBL: ENSMUSP00000052661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050300] [ENSMUST00000118419] [ENSMUST00000209935]
Predicted Effect probably damaging
Transcript: ENSMUST00000050300
AA Change: E129K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052661
Gene: ENSMUSG00000031554
AA Change: E129K

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pep_M12B_propep 16 142 1.6e-19 PFAM
Pfam:Reprolysin 185 378 7.7e-59 PFAM
DISIN 397 474 9.1e-42 SMART
ACR 475 618 6.9e-58 SMART
transmembrane domain 695 712 N/A INTRINSIC
low complexity region 718 751 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118419
AA Change: E129K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112422
Gene: ENSMUSG00000031554
AA Change: E129K

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pep_M12B_propep 16 142 4.7e-30 PFAM
Pfam:Reprolysin 185 378 7.9e-56 PFAM
DISIN 397 474 1.78e-39 SMART
ACR 475 618 2.06e-55 SMART
transmembrane domain 695 712 N/A INTRINSIC
low complexity region 718 750 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000121272
Gene: ENSMUSG00000031554
AA Change: E46K

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 1 60 6.7e-14 PFAM
Pfam:Reprolysin 103 296 2.5e-61 PFAM
DISIN 315 392 1.78e-39 SMART
ACR 393 536 2.06e-55 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209935
AA Change: E129K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of related ADAM genes on chromosome 8. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt T A 9: 4,296,823 D261V probably benign Het
Abca8a T C 11: 110,090,050 Y54C probably damaging Het
Adad2 T C 8: 119,616,007 S431P probably benign Het
Adam18 A G 8: 24,628,230 Y557H possibly damaging Het
Adgra2 T C 8: 27,119,223 V824A probably benign Het
Armc12 A T 17: 28,532,436 K135* probably null Het
Aup1 C T 6: 83,055,929 Q215* probably null Het
AW146154 G A 7: 41,480,511 R394C probably benign Het
Canx T G 11: 50,311,704 D25A possibly damaging Het
Ccnf A G 17: 24,225,015 L593P probably damaging Het
Cd40 A T 2: 165,056,775 I41F unknown Het
Cdh1 C T 8: 106,657,773 A291V probably benign Het
Cdhr2 A T 13: 54,731,070 I963F probably damaging Het
Cenpe G A 3: 135,243,718 G88D probably damaging Het
Cep295 T A 9: 15,322,586 T2305S possibly damaging Het
Clcn4 T C 7: 7,296,759 R24G probably damaging Het
Cnot7 T C 8: 40,507,473 N98S possibly damaging Het
Defa3 T G 8: 21,288,272 C91G probably damaging Het
Dennd2c T C 3: 103,165,130 F844L probably damaging Het
Dido1 T C 2: 180,660,912 D1733G probably benign Het
Dnah7b G A 1: 46,224,706 W2116* probably null Het
Dnaja3 T C 16: 4,684,267 V45A probably benign Het
Efcab7 T A 4: 99,829,378 S11T unknown Het
Enpp2 T A 15: 54,847,301 K744N probably damaging Het
Fam171b CCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGC 2: 83,812,874 probably benign Het
Fdxacb1 T G 9: 50,768,835 F107C probably damaging Het
Fnbp1 A T 2: 31,036,594 Y433N probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm15446 T A 5: 109,940,440 Y6* probably null Het
Gm45140 T C 6: 87,819,569 H66R Het
Grin3b G A 10: 79,977,034 R981Q unknown Het
Ipp T G 4: 116,510,856 I95M probably benign Het
Iqca A G 1: 90,045,744 F769L probably damaging Het
Jkamp C T 12: 72,090,058 L67F probably damaging Het
Llgl2 T A 11: 115,853,286 M773K probably damaging Het
Man2b1 A G 8: 85,097,045 T973A probably benign Het
Mcm2 T C 6: 88,892,057 Y271C probably damaging Het
Msl2 T C 9: 101,100,960 S178P probably benign Het
Myo7a G T 7: 98,083,626 S648* probably null Het
Neurl1b G T 17: 26,432,227 V158F probably damaging Het
Nkain2 A G 10: 32,890,038 V142A unknown Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Odf3 A T 7: 140,850,302 T201S probably benign Het
Olfr1124 A T 2: 87,435,020 N178Y possibly damaging Het
Olfr259 A G 2: 87,108,067 Y107H probably damaging Het
Oma1 A T 4: 103,319,035 probably benign Het
Plekhg6 T C 6: 125,363,046 T784A probably benign Het
Prtg T C 9: 72,844,983 I217T probably benign Het
Ptx4 T C 17: 25,122,779 F76S probably damaging Het
Rap1b A C 10: 117,821,609 I55S probably damaging Het
Sftpd T C 14: 41,172,581 T294A probably benign Het
Spg11 C T 2: 122,113,156 V172I probably benign Het
Srms T A 2: 181,206,958 H363L probably damaging Het
Tbc1d13 A T 2: 30,147,403 M266L probably damaging Het
Tbc1d2 A C 4: 46,649,737 C100G possibly damaging Het
Tdg A T 10: 82,638,793 Q39L probably benign Het
Tiam1 G A 16: 89,789,258 A1547V probably benign Het
Trpm1 A G 7: 64,208,970 E380G possibly damaging Het
Unc13b T G 4: 43,177,597 D2808E unknown Het
Usp25 A T 16: 77,069,055 D287V possibly damaging Het
Zfp648 A T 1: 154,204,116 Q7L probably benign Het
Zfp931 T C 2: 178,067,916 R226G probably benign Het
Zfyve9 T A 4: 108,685,018 E201D probably benign Het
Other mutations in Adam5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Adam5 APN 8 24818742 missense probably benign 0.18
IGL01285:Adam5 APN 8 24781594 missense probably benign 0.02
IGL01310:Adam5 APN 8 24742134 intron probably benign
IGL01510:Adam5 APN 8 24804465 missense probably damaging 1.00
IGL01570:Adam5 APN 8 24810823 missense probably damaging 1.00
IGL02017:Adam5 APN 8 24781759 missense probably benign 0.38
IGL02191:Adam5 APN 8 24812423 nonsense probably null
IGL02397:Adam5 APN 8 24744133 intron probably benign
IGL02488:Adam5 APN 8 24792006 missense probably damaging 0.98
IGL02490:Adam5 APN 8 24781704 nonsense probably null
IGL02499:Adam5 APN 8 24781565 critical splice donor site probably null
IGL02539:Adam5 APN 8 24786213 nonsense probably null
IGL02590:Adam5 APN 8 24744135 intron probably benign
IGL02677:Adam5 APN 8 24812379 splice site probably benign
IGL02679:Adam5 APN 8 24806526 missense probably damaging 1.00
IGL02982:Adam5 APN 8 24804431 missense probably benign 0.02
IGL03146:Adam5 APN 8 24804503 missense probably damaging 0.98
IGL03162:Adam5 APN 8 24781604 missense probably benign 0.30
IGL03284:Adam5 APN 8 24786338 splice site probably benign
R0081:Adam5 UTSW 8 24781687 missense probably damaging 1.00
R0377:Adam5 UTSW 8 24747541 missense probably benign 0.08
R0398:Adam5 UTSW 8 24813432 missense probably benign 0.17
R0771:Adam5 UTSW 8 24786299 missense probably benign 0.04
R0925:Adam5 UTSW 8 24812425 missense probably benign 0.09
R1547:Adam5 UTSW 8 24810713 missense probably benign 0.10
R1985:Adam5 UTSW 8 24746739 missense probably benign 0.01
R2115:Adam5 UTSW 8 24744145 intron probably benign
R2125:Adam5 UTSW 8 24815118 missense probably damaging 1.00
R2144:Adam5 UTSW 8 24815480 missense probably benign 0.14
R3151:Adam5 UTSW 8 24781631 missense probably damaging 0.99
R3612:Adam5 UTSW 8 24818089 splice site probably benign
R3844:Adam5 UTSW 8 24813410 missense probably benign 0.12
R3873:Adam5 UTSW 8 24815109 missense probably benign 0.02
R4514:Adam5 UTSW 8 24818136 missense probably damaging 1.00
R4843:Adam5 UTSW 8 24813536 missense probably damaging 1.00
R4866:Adam5 UTSW 8 24742156 splice site probably null
R4866:Adam5 UTSW 8 24781603 missense probably damaging 0.98
R4900:Adam5 UTSW 8 24742156 splice site probably null
R4900:Adam5 UTSW 8 24781603 missense probably damaging 0.98
R4903:Adam5 UTSW 8 24786232 missense probably damaging 1.00
R4936:Adam5 UTSW 8 24786271 missense probably damaging 1.00
R4964:Adam5 UTSW 8 24786232 missense probably damaging 1.00
R5259:Adam5 UTSW 8 24810834 missense possibly damaging 0.90
R5293:Adam5 UTSW 8 24810706 missense possibly damaging 0.46
R5724:Adam5 UTSW 8 24804495 nonsense probably null
R5859:Adam5 UTSW 8 24813461 missense probably benign
R6004:Adam5 UTSW 8 24781669 missense probably benign 0.04
R6175:Adam5 UTSW 8 24786151 missense probably benign 0.00
R6539:Adam5 UTSW 8 24782600 missense possibly damaging 0.85
R6994:Adam5 UTSW 8 24786246 nonsense probably null
R6996:Adam5 UTSW 8 24806501 missense probably damaging 1.00
R7009:Adam5 UTSW 8 24806438 missense probably benign 0.00
R7115:Adam5 UTSW 8 24781696 missense possibly damaging 0.69
R7127:Adam5 UTSW 8 24810781 missense probably damaging 1.00
R7469:Adam5 UTSW 8 24815525 missense probably benign 0.45
R7780:Adam5 UTSW 8 24804416 missense possibly damaging 0.49
R8027:Adam5 UTSW 8 24782558 missense probably damaging 1.00
R8138:Adam5 UTSW 8 24781762 missense probably damaging 1.00
R8305:Adam5 UTSW 8 24810703 missense possibly damaging 0.93
R8359:Adam5 UTSW 8 24806486 missense probably damaging 1.00
R8480:Adam5 UTSW 8 24804459 nonsense probably null
R8743:Adam5 UTSW 8 24786248 missense probably damaging 1.00
X0019:Adam5 UTSW 8 24812443 missense probably benign 0.00
X0022:Adam5 UTSW 8 24813563 critical splice acceptor site probably null
X0027:Adam5 UTSW 8 24818772 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTACAAAGTAAAACCATGCCGG -3'
(R):5'- AGCACAGTGATGTAGTTCTGGG -3'

Sequencing Primer
(F):5'- GCCTTTAACATCAGCACTTGGGAG -3'
(R):5'- CACAGTGATGTAGTTCTGGGATAACC -3'
Posted On2020-01-23