Incidental Mutation 'R8069:Llgl2'
ID620189
Institutional Source Beutler Lab
Gene Symbol Llgl2
Ensembl Gene ENSMUSG00000020782
Gene NameLLGL2 scribble cell polarity complex component
Synonyms9130006H11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R8069 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location115824049-115855780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115853286 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 773 (M773K)
Ref Sequence ENSEMBL: ENSMUSP00000099321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103032] [ENSMUST00000177736]
Predicted Effect probably damaging
Transcript: ENSMUST00000103032
AA Change: M773K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099321
Gene: ENSMUSG00000020782
AA Change: M773K

DomainStartEndE-ValueType
WD40 24 60 9.17e1 SMART
WD40 62 101 7.96e0 SMART
Blast:WD40 112 157 6e-20 BLAST
WD40 181 217 3.96e1 SMART
WD40 221 258 5.7e1 SMART
Pfam:LLGL 268 372 3.2e-47 PFAM
WD40 411 451 1.38e0 SMART
Blast:WD40 489 532 3e-12 BLAST
low complexity region 536 547 N/A INTRINSIC
Blast:WD40 576 615 2e-10 BLAST
low complexity region 649 668 N/A INTRINSIC
Blast:WD40 830 879 2e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000128826
Predicted Effect probably benign
Transcript: ENSMUST00000177736
AA Change: M797K

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000136054
Gene: ENSMUSG00000020782
AA Change: M797K

DomainStartEndE-ValueType
WD40 24 60 5.9e-1 SMART
WD40 62 101 5.2e-2 SMART
Blast:WD40 112 157 6e-20 BLAST
WD40 181 217 2.5e-1 SMART
WD40 221 258 3.6e-1 SMART
Pfam:LLGL 271 372 6.2e-41 PFAM
WD40 411 451 8.8e-3 SMART
Blast:WD40 489 532 3e-12 BLAST
low complexity region 536 547 N/A INTRINSIC
Blast:WD40 576 615 2e-10 BLAST
low complexity region 649 668 N/A INTRINSIC
Blast:WD40 854 903 2e-10 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The lethal (2) giant larvae protein of Drosophila plays a role in asymmetric cell division, epithelial cell polarity, and cell migration. This human gene encodes a protein similar to lethal (2) giant larvae of Drosophila. In fly, the protein's ability to localize cell fate determinants is regulated by the atypical protein kinase C (aPKC). In human, this protein interacts with aPKC-containing complexes and is cortically localized in mitotic cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit abnormal branching morphogenesis of the placental labyrinth layer and are born as runts but catch up in size by adulthood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt T A 9: 4,296,823 D261V probably benign Het
Abca8a T C 11: 110,090,050 Y54C probably damaging Het
Adad2 T C 8: 119,616,007 S431P probably benign Het
Adam18 A G 8: 24,628,230 Y557H possibly damaging Het
Adam5 C T 8: 24,813,525 E129K probably damaging Het
Adgra2 T C 8: 27,119,223 V824A probably benign Het
Armc12 A T 17: 28,532,436 K135* probably null Het
Aup1 C T 6: 83,055,929 Q215* probably null Het
AW146154 G A 7: 41,480,511 R394C probably benign Het
Canx T G 11: 50,311,704 D25A possibly damaging Het
Ccnf A G 17: 24,225,015 L593P probably damaging Het
Cd40 A T 2: 165,056,775 I41F unknown Het
Cdh1 C T 8: 106,657,773 A291V probably benign Het
Cdhr2 A T 13: 54,731,070 I963F probably damaging Het
Cenpe G A 3: 135,243,718 G88D probably damaging Het
Cep295 T A 9: 15,322,586 T2305S possibly damaging Het
Clcn4 T C 7: 7,296,759 R24G probably damaging Het
Cnot7 T C 8: 40,507,473 N98S possibly damaging Het
Defa3 T G 8: 21,288,272 C91G probably damaging Het
Dennd2c T C 3: 103,165,130 F844L probably damaging Het
Dido1 T C 2: 180,660,912 D1733G probably benign Het
Dnah7b G A 1: 46,224,706 W2116* probably null Het
Dnaja3 T C 16: 4,684,267 V45A probably benign Het
Efcab7 T A 4: 99,829,378 S11T unknown Het
Enpp2 T A 15: 54,847,301 K744N probably damaging Het
Fam171b CCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGC 2: 83,812,874 probably benign Het
Fdxacb1 T G 9: 50,768,835 F107C probably damaging Het
Fnbp1 A T 2: 31,036,594 Y433N probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm15446 T A 5: 109,940,440 Y6* probably null Het
Gm45140 T C 6: 87,819,569 H66R Het
Grin3b G A 10: 79,977,034 R981Q unknown Het
Ipp T G 4: 116,510,856 I95M probably benign Het
Iqca A G 1: 90,045,744 F769L probably damaging Het
Jkamp C T 12: 72,090,058 L67F probably damaging Het
Man2b1 A G 8: 85,097,045 T973A probably benign Het
Mcm2 T C 6: 88,892,057 Y271C probably damaging Het
Msl2 T C 9: 101,100,960 S178P probably benign Het
Myo7a G T 7: 98,083,626 S648* probably null Het
Neurl1b G T 17: 26,432,227 V158F probably damaging Het
Nkain2 A G 10: 32,890,038 V142A unknown Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Odf3 A T 7: 140,850,302 T201S probably benign Het
Olfr1124 A T 2: 87,435,020 N178Y possibly damaging Het
Olfr259 A G 2: 87,108,067 Y107H probably damaging Het
Oma1 A T 4: 103,319,035 probably benign Het
Plekhg6 T C 6: 125,363,046 T784A probably benign Het
Prtg T C 9: 72,844,983 I217T probably benign Het
Ptx4 T C 17: 25,122,779 F76S probably damaging Het
Rap1b A C 10: 117,821,609 I55S probably damaging Het
Sftpd T C 14: 41,172,581 T294A probably benign Het
Spg11 C T 2: 122,113,156 V172I probably benign Het
Srms T A 2: 181,206,958 H363L probably damaging Het
Tbc1d13 A T 2: 30,147,403 M266L probably damaging Het
Tbc1d2 A C 4: 46,649,737 C100G possibly damaging Het
Tdg A T 10: 82,638,793 Q39L probably benign Het
Tiam1 G A 16: 89,789,258 A1547V probably benign Het
Trpm1 A G 7: 64,208,970 E380G possibly damaging Het
Unc13b T G 4: 43,177,597 D2808E unknown Het
Usp25 A T 16: 77,069,055 D287V possibly damaging Het
Zfp648 A T 1: 154,204,116 Q7L probably benign Het
Zfp931 T C 2: 178,067,916 R226G probably benign Het
Zfyve9 T A 4: 108,685,018 E201D probably benign Het
Other mutations in Llgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Llgl2 APN 11 115834884 missense probably benign 0.00
IGL01145:Llgl2 APN 11 115853805 missense probably benign
IGL01344:Llgl2 APN 11 115851193 missense probably benign 0.01
IGL01980:Llgl2 APN 11 115850025 missense probably damaging 1.00
IGL02220:Llgl2 APN 11 115845379 missense possibly damaging 0.64
IGL02341:Llgl2 APN 11 115851120 missense possibly damaging 0.70
IGL02399:Llgl2 APN 11 115844835 missense probably damaging 0.97
IGL02415:Llgl2 APN 11 115853285 missense probably damaging 0.98
IGL02632:Llgl2 APN 11 115844872 missense probably damaging 1.00
IGL02990:Llgl2 APN 11 115854333 missense probably benign 0.01
IGL03405:Llgl2 APN 11 115850842 missense probably benign 0.09
R0097:Llgl2 UTSW 11 115844497 nonsense probably null
R0166:Llgl2 UTSW 11 115844854 missense probably damaging 1.00
R0277:Llgl2 UTSW 11 115850720 missense probably damaging 1.00
R0323:Llgl2 UTSW 11 115850720 missense probably damaging 1.00
R0345:Llgl2 UTSW 11 115849992 splice site probably benign
R0614:Llgl2 UTSW 11 115850267 missense probably damaging 1.00
R0980:Llgl2 UTSW 11 115850001 missense probably damaging 1.00
R1387:Llgl2 UTSW 11 115853132 missense probably damaging 0.99
R1456:Llgl2 UTSW 11 115845499 missense probably benign 0.00
R1541:Llgl2 UTSW 11 115853121 missense probably benign 0.00
R1832:Llgl2 UTSW 11 115851100 missense probably damaging 1.00
R1950:Llgl2 UTSW 11 115851066 missense probably damaging 0.96
R2991:Llgl2 UTSW 11 115851120 missense probably benign 0.05
R4018:Llgl2 UTSW 11 115847612 missense probably benign 0.31
R4582:Llgl2 UTSW 11 115850706 missense possibly damaging 0.89
R4729:Llgl2 UTSW 11 115848299 missense probably damaging 0.98
R4907:Llgl2 UTSW 11 115853974 nonsense probably null
R5000:Llgl2 UTSW 11 115844902 missense probably benign
R5016:Llgl2 UTSW 11 115853424 missense probably damaging 1.00
R5175:Llgl2 UTSW 11 115850721 missense probably damaging 1.00
R5857:Llgl2 UTSW 11 115850281 missense probably damaging 1.00
R6190:Llgl2 UTSW 11 115846986 missense probably benign 0.00
R6451:Llgl2 UTSW 11 115844941 missense probably damaging 0.99
R6804:Llgl2 UTSW 11 115843315 critical splice acceptor site probably null
R6909:Llgl2 UTSW 11 115850799 missense probably damaging 1.00
R7324:Llgl2 UTSW 11 115850730 missense possibly damaging 0.49
R7332:Llgl2 UTSW 11 115848299 missense probably damaging 0.98
R7715:Llgl2 UTSW 11 115849728 missense probably benign
R8038:Llgl2 UTSW 11 115851103 missense probably benign 0.17
X0058:Llgl2 UTSW 11 115850637 missense probably damaging 0.99
Z1176:Llgl2 UTSW 11 115849554 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACAGATGAACCTGTCCGG -3'
(R):5'- GGCCCTTACTCCAATGCAAC -3'

Sequencing Primer
(F):5'- ATGAACCTGTCCGGGCAGAG -3'
(R):5'- TGGTGCCTTAGGGACATCCAG -3'
Posted On2020-01-23