Mutagenetix > Incidental Mutation

Incidental Mutation 'R8069:Ccnf'

620197

Institutional Source

Beutler Lab

Gene Symbol

Ccnf

Ensembl Gene

ENSMUSG00000072082

Gene Name

cyclin F

Synonyms

CycF, Fbxo1

MMRRC Submission

067504-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8069 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

24441518-24470333 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24443989 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 593 (L593P)

Ref Sequence

ENSEMBL: ENSMUSP00000111048 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024930] [ENSMUST00000115390]

AlphaFold

P51944

Predicted Effect

probably benign
Transcript: ENSMUST00000024930

SMART Domains

Protein: ENSMUSP00000024930
Gene: ENSMUSG00000024118

Domain	Start	End	E-Value	Type
low complexity region	32	49	N/A	INTRINSIC
low complexity region	78	84	N/A	INTRINSIC
low complexity region	111	131	N/A	INTRINSIC
Pfam:DUF4693	150	434	8.6e-145	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000115390
AA Change: L593P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000111048
Gene: ENSMUSG00000072082
AA Change: L593P

Domain	Start	End	E-Value	Type
FBOX	35	75	1.56e-6	SMART
CYCLIN	315	399	2.25e-13	SMART
Cyclin_C	408	531	2.58e-19	SMART
CYCLIN	416	494	2.27e-9	SMART
low complexity region	545	555	N/A	INTRINSIC
low complexity region	563	574	N/A	INTRINSIC
low complexity region	695	708	N/A	INTRINSIC
low complexity region	719	731	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124557

SMART Domains

Protein: ENSMUSP00000119405
Gene: ENSMUSG00000024118

Domain	Start	End	E-Value	Type
low complexity region	16	32	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cyclin family. Cyclins are important regulators of cell cycle transitions through their ability to bind and activate cyclin-dependent protein kinases. This member also belongs to the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it was one of the first proteins in which the F-box motif was identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality between E9.5 and E10.5 due to defects in yolk sac and chorioallantoic placenta maturation. Embryos show incomplete turning, underdeveloped posterior structures, neural tube closure and braindefects. MEFs have cell cycle defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdhppt	T	A	9: 4,296,823 (GRCm39)	D261V	probably benign	Het
Abca8a	T	C	11: 109,980,876 (GRCm39)	Y54C	probably damaging	Het
Adad2	T	C	8: 120,342,746 (GRCm39)	S431P	probably benign	Het
Adam18	A	G	8: 25,118,246 (GRCm39)	Y557H	possibly damaging	Het
Adam5	C	T	8: 25,303,541 (GRCm39)	E129K	probably damaging	Het
Adgra2	T	C	8: 27,609,251 (GRCm39)	V824A	probably benign	Het
Armc12	A	T	17: 28,751,410 (GRCm39)	K135*	probably null	Het
Aup1	C	T	6: 83,032,910 (GRCm39)	Q215*	probably null	Het
AW146154	G	A	7: 41,129,935 (GRCm39)	R394C	probably benign	Het
Canx	T	G	11: 50,202,531 (GRCm39)	D25A	possibly damaging	Het
Cd40	A	T	2: 164,898,695 (GRCm39)	I41F	unknown	Het
Cdh1	C	T	8: 107,384,405 (GRCm39)	A291V	probably benign	Het
Cdhr2	A	T	13: 54,878,883 (GRCm39)	I963F	probably damaging	Het
Cenpe	G	A	3: 134,949,479 (GRCm39)	G88D	probably damaging	Het
Cep295	T	A	9: 15,233,882 (GRCm39)	T2305S	possibly damaging	Het
Cimap1a	A	T	7: 140,430,215 (GRCm39)	T201S	probably benign	Het
Clcn4	T	C	7: 7,299,758 (GRCm39)	R24G	probably damaging	Het
Cnot7	T	C	8: 40,960,514 (GRCm39)	N98S	possibly damaging	Het
Defa3	T	G	8: 21,778,288 (GRCm39)	C91G	probably damaging	Het
Dennd2c	T	C	3: 103,072,446 (GRCm39)	F844L	probably damaging	Het
Dido1	T	C	2: 180,302,705 (GRCm39)	D1733G	probably benign	Het
Dnah7b	G	A	1: 46,263,866 (GRCm39)	W2116*	probably null	Het
Dnaja3	T	C	16: 4,502,131 (GRCm39)	V45A	probably benign	Het
Efcab7	T	A	4: 99,717,615 (GRCm39)	S11T	unknown	Het
Enpp2	T	A	15: 54,710,697 (GRCm39)	K744N	probably damaging	Het
Fam171b	CCAGCAGCAGCAGCAGCAGCAGC	CCAGCAGCAGCAGCAGCAGC	2: 83,643,218 (GRCm39)		probably benign	Het
Fdxacb1	T	G	9: 50,680,135 (GRCm39)	F107C	probably damaging	Het
Fnbp1	A	T	2: 30,926,606 (GRCm39)	Y433N	probably damaging	Het
Gatad1	T	C	5: 3,693,540 (GRCm39)	R210G	probably benign	Het
Gm15446	T	A	5: 110,088,306 (GRCm39)	Y6*	probably null	Het
Gm45140	T	C	6: 87,796,551 (GRCm39)	H66R		Het
Grin3b	G	A	10: 79,812,868 (GRCm39)	R981Q	unknown	Het
Ipp	T	G	4: 116,368,053 (GRCm39)	I95M	probably benign	Het
Iqca1	A	G	1: 89,973,466 (GRCm39)	F769L	probably damaging	Het
Jkamp	C	T	12: 72,136,832 (GRCm39)	L67F	probably damaging	Het
Llgl2	T	A	11: 115,744,112 (GRCm39)	M773K	probably damaging	Het
Man2b1	A	G	8: 85,823,674 (GRCm39)	T973A	probably benign	Het
Mcm2	T	C	6: 88,869,039 (GRCm39)	Y271C	probably damaging	Het
Msl2	T	C	9: 100,978,159 (GRCm39)	S178P	probably benign	Het
Myo7a	G	T	7: 97,732,833 (GRCm39)	S648*	probably null	Het
Neurl1b	G	T	17: 26,651,201 (GRCm39)	V158F	probably damaging	Het
Nkain2	A	G	10: 32,766,034 (GRCm39)	V142A	unknown	Het
Nrp2	C	T	1: 62,784,567 (GRCm39)	R239C	probably damaging	Het
Oma1	A	T	4: 103,176,232 (GRCm39)		probably benign	Het
Or10ag58	A	T	2: 87,265,364 (GRCm39)	N178Y	possibly damaging	Het
Or5aq7	A	G	2: 86,938,411 (GRCm39)	Y107H	probably damaging	Het
Plekhg6	T	C	6: 125,340,009 (GRCm39)	T784A	probably benign	Het
Prtg	T	C	9: 72,752,265 (GRCm39)	I217T	probably benign	Het
Ptx4	T	C	17: 25,341,753 (GRCm39)	F76S	probably damaging	Het
Rap1b	A	C	10: 117,657,514 (GRCm39)	I55S	probably damaging	Het
Sftpd	T	C	14: 40,894,538 (GRCm39)	T294A	probably benign	Het
Spg11	C	T	2: 121,943,637 (GRCm39)	V172I	probably benign	Het
Srms	T	A	2: 180,848,751 (GRCm39)	H363L	probably damaging	Het
Tbc1d13	A	T	2: 30,037,415 (GRCm39)	M266L	probably damaging	Het
Tbc1d2	A	C	4: 46,649,737 (GRCm39)	C100G	possibly damaging	Het
Tdg	A	T	10: 82,474,627 (GRCm39)	Q39L	probably benign	Het
Tiam1	G	A	16: 89,586,146 (GRCm39)	A1547V	probably benign	Het
Trpm1	A	G	7: 63,858,718 (GRCm39)	E380G	possibly damaging	Het
Unc13b	T	G	4: 43,177,597 (GRCm39)	D2808E	unknown	Het
Usp25	A	T	16: 76,865,943 (GRCm39)	D287V	possibly damaging	Het
Zfp648	A	T	1: 154,079,862 (GRCm39)	Q7L	probably benign	Het
Zfp931	T	C	2: 177,709,709 (GRCm39)	R226G	probably benign	Het
Zfyve9	T	A	4: 108,542,215 (GRCm39)	E201D	probably benign	Het

Other mutations in Ccnf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01399:Ccnf	APN	17	24,443,986 (GRCm39)	missense	probably damaging	1.00
IGL01942:Ccnf	APN	17	24,461,294 (GRCm39)	missense	probably benign	0.03
IGL02251:Ccnf	APN	17	24,445,513 (GRCm39)	missense	probably benign	0.00
IGL02945:Ccnf	APN	17	24,443,890 (GRCm39)	missense	probably damaging	0.99
IGL02952:Ccnf	APN	17	24,450,299 (GRCm39)	missense	possibly damaging	0.93
albuquerque	UTSW	17	24,442,971 (GRCm39)	nonsense	probably null
R0326:Ccnf	UTSW	17	24,450,784 (GRCm39)	missense	possibly damaging	0.84
R0891:Ccnf	UTSW	17	24,445,751 (GRCm39)	missense	possibly damaging	0.93
R1069:Ccnf	UTSW	17	24,442,971 (GRCm39)	nonsense	probably null
R1072:Ccnf	UTSW	17	24,456,136 (GRCm39)	missense	probably damaging	0.97
R1693:Ccnf	UTSW	17	24,445,514 (GRCm39)	frame shift	probably null
R2147:Ccnf	UTSW	17	24,449,288 (GRCm39)	critical splice donor site	probably null
R3929:Ccnf	UTSW	17	24,453,356 (GRCm39)	missense	probably damaging	1.00
R4081:Ccnf	UTSW	17	24,442,872 (GRCm39)	makesense	probably null
R4260:Ccnf	UTSW	17	24,445,741 (GRCm39)	missense	probably damaging	1.00
R4579:Ccnf	UTSW	17	24,450,303 (GRCm39)	nonsense	probably null
R4651:Ccnf	UTSW	17	24,450,760 (GRCm39)	missense	probably damaging	1.00
R4844:Ccnf	UTSW	17	24,449,331 (GRCm39)	nonsense	probably null
R4876:Ccnf	UTSW	17	24,449,311 (GRCm39)	missense	probably damaging	1.00
R5234:Ccnf	UTSW	17	24,453,411 (GRCm39)	nonsense	probably null
R5352:Ccnf	UTSW	17	24,462,247 (GRCm39)	splice site	probably null
R5845:Ccnf	UTSW	17	24,459,767 (GRCm39)	missense	possibly damaging	0.95
R6084:Ccnf	UTSW	17	24,450,811 (GRCm39)	missense	probably damaging	1.00
R6219:Ccnf	UTSW	17	24,445,678 (GRCm39)	nonsense	probably null
R7021:Ccnf	UTSW	17	24,461,205 (GRCm39)	missense	probably damaging	1.00
R7176:Ccnf	UTSW	17	24,468,376 (GRCm39)	missense	possibly damaging	0.54
R7180:Ccnf	UTSW	17	24,442,889 (GRCm39)	missense	probably benign	0.00
R7485:Ccnf	UTSW	17	24,468,232 (GRCm39)	missense	probably damaging	0.97
R7763:Ccnf	UTSW	17	24,443,986 (GRCm39)	missense	probably damaging	1.00
R8016:Ccnf	UTSW	17	24,450,784 (GRCm39)	missense	possibly damaging	0.84
R8034:Ccnf	UTSW	17	24,450,805 (GRCm39)	missense	probably damaging	1.00
R9021:Ccnf	UTSW	17	24,445,679 (GRCm39)	nonsense	probably null
R9623:Ccnf	UTSW	17	24,468,367 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCTCAGTACAGTGCCAGATG -3'
(R):5'- ACATCTGCCCTAGCTTCATGTG -3'

Sequencing Primer
(F):5'- AGATGGCCCTCAGATCATGTGTC -3'
(R):5'- TTTTCTAGAACACACGGTGAGAGCC -3'

Posted On

2020-01-23