Incidental Mutation 'R8069:Ptx4'
ID620198
Institutional Source Beutler Lab
Gene Symbol Ptx4
Ensembl Gene ENSMUSG00000044172
Gene Namepentraxin 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.404) question?
Stock #R8069 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location25120760-25125268 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25122779 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 76 (F76S)
Ref Sequence ENSEMBL: ENSMUSP00000055984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054930]
Predicted Effect probably damaging
Transcript: ENSMUST00000054930
AA Change: F76S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055984
Gene: ENSMUSG00000044172
AA Change: F76S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Blast:HOX 32 122 3e-35 BLAST
coiled coil region 147 182 N/A INTRINSIC
Pfam:Pentaxin 271 460 7.3e-33 PFAM
Pfam:Laminin_G_3 277 440 2.4e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the pentraxin superfamily, whose members encode highly conserved multifunctional proteins. The encoded protein, like other members of this family, contains a conserved pentraxin domain at the C-terminus. The highest levels of expression of the protein were observed in bone marrow, small intestine and testes. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt T A 9: 4,296,823 D261V probably benign Het
Abca8a T C 11: 110,090,050 Y54C probably damaging Het
Adad2 T C 8: 119,616,007 S431P probably benign Het
Adam18 A G 8: 24,628,230 Y557H possibly damaging Het
Adam5 C T 8: 24,813,525 E129K probably damaging Het
Adgra2 T C 8: 27,119,223 V824A probably benign Het
Armc12 A T 17: 28,532,436 K135* probably null Het
Aup1 C T 6: 83,055,929 Q215* probably null Het
AW146154 G A 7: 41,480,511 R394C probably benign Het
Canx T G 11: 50,311,704 D25A possibly damaging Het
Ccnf A G 17: 24,225,015 L593P probably damaging Het
Cd40 A T 2: 165,056,775 I41F unknown Het
Cdh1 C T 8: 106,657,773 A291V probably benign Het
Cdhr2 A T 13: 54,731,070 I963F probably damaging Het
Cenpe G A 3: 135,243,718 G88D probably damaging Het
Cep295 T A 9: 15,322,586 T2305S possibly damaging Het
Clcn4 T C 7: 7,296,759 R24G probably damaging Het
Cnot7 T C 8: 40,507,473 N98S possibly damaging Het
Defa3 T G 8: 21,288,272 C91G probably damaging Het
Dennd2c T C 3: 103,165,130 F844L probably damaging Het
Dido1 T C 2: 180,660,912 D1733G probably benign Het
Dnah7b G A 1: 46,224,706 W2116* probably null Het
Dnaja3 T C 16: 4,684,267 V45A probably benign Het
Efcab7 T A 4: 99,829,378 S11T unknown Het
Enpp2 T A 15: 54,847,301 K744N probably damaging Het
Fam171b CCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGC 2: 83,812,874 probably benign Het
Fdxacb1 T G 9: 50,768,835 F107C probably damaging Het
Fnbp1 A T 2: 31,036,594 Y433N probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm15446 T A 5: 109,940,440 Y6* probably null Het
Gm45140 T C 6: 87,819,569 H66R Het
Grin3b G A 10: 79,977,034 R981Q unknown Het
Ipp T G 4: 116,510,856 I95M probably benign Het
Iqca A G 1: 90,045,744 F769L probably damaging Het
Jkamp C T 12: 72,090,058 L67F probably damaging Het
Llgl2 T A 11: 115,853,286 M773K probably damaging Het
Man2b1 A G 8: 85,097,045 T973A probably benign Het
Mcm2 T C 6: 88,892,057 Y271C probably damaging Het
Msl2 T C 9: 101,100,960 S178P probably benign Het
Myo7a G T 7: 98,083,626 S648* probably null Het
Neurl1b G T 17: 26,432,227 V158F probably damaging Het
Nkain2 A G 10: 32,890,038 V142A unknown Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Odf3 A T 7: 140,850,302 T201S probably benign Het
Olfr1124 A T 2: 87,435,020 N178Y possibly damaging Het
Olfr259 A G 2: 87,108,067 Y107H probably damaging Het
Oma1 A T 4: 103,319,035 probably benign Het
Plekhg6 T C 6: 125,363,046 T784A probably benign Het
Prtg T C 9: 72,844,983 I217T probably benign Het
Rap1b A C 10: 117,821,609 I55S probably damaging Het
Sftpd T C 14: 41,172,581 T294A probably benign Het
Spg11 C T 2: 122,113,156 V172I probably benign Het
Srms T A 2: 181,206,958 H363L probably damaging Het
Tbc1d13 A T 2: 30,147,403 M266L probably damaging Het
Tbc1d2 A C 4: 46,649,737 C100G possibly damaging Het
Tdg A T 10: 82,638,793 Q39L probably benign Het
Tiam1 G A 16: 89,789,258 A1547V probably benign Het
Trpm1 A G 7: 64,208,970 E380G possibly damaging Het
Unc13b T G 4: 43,177,597 D2808E unknown Het
Usp25 A T 16: 77,069,055 D287V possibly damaging Het
Zfp648 A T 1: 154,204,116 Q7L probably benign Het
Zfp931 T C 2: 178,067,916 R226G probably benign Het
Zfyve9 T A 4: 108,685,018 E201D probably benign Het
Other mutations in Ptx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03027:Ptx4 APN 17 25125048 missense possibly damaging 0.81
IGL03373:Ptx4 APN 17 25120899 missense probably benign 0.02
IGL03394:Ptx4 APN 17 25124675 missense probably damaging 1.00
R0559:Ptx4 UTSW 17 25123108 nonsense probably null
R3765:Ptx4 UTSW 17 25122868 missense probably benign 0.02
R4629:Ptx4 UTSW 17 25122763 missense probably damaging 1.00
R4677:Ptx4 UTSW 17 25123126 missense probably benign 0.05
R4938:Ptx4 UTSW 17 25123165 nonsense probably null
R5170:Ptx4 UTSW 17 25123178 missense probably benign 0.01
R5517:Ptx4 UTSW 17 25124786 missense possibly damaging 0.58
R6614:Ptx4 UTSW 17 25122702 missense possibly damaging 0.70
R6993:Ptx4 UTSW 17 25124924 missense possibly damaging 0.70
R7070:Ptx4 UTSW 17 25122997 missense probably benign 0.04
R7230:Ptx4 UTSW 17 25123103 missense possibly damaging 0.95
R7501:Ptx4 UTSW 17 25125192 missense possibly damaging 0.95
R7845:Ptx4 UTSW 17 25124954 missense possibly damaging 0.95
R8244:Ptx4 UTSW 17 25122865 missense possibly damaging 0.87
R8370:Ptx4 UTSW 17 25123340 missense possibly damaging 0.90
R8388:Ptx4 UTSW 17 25120923 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGAACCATCCATAGACTTGG -3'
(R):5'- TGCAATAGCCTCCCTCTGTG -3'

Sequencing Primer
(F):5'- ACCCCATAAGAGCTGTGT -3'
(R):5'- AATAGCCTCCCTCTGTGCCTTTTG -3'
Posted On2020-01-23