Mutagenetix > Incidental Mutations

Incidental Mutation 'R0666:Clpx'

62020

Institutional Source

Beutler Lab

Gene Symbol

Clpx

Ensembl Gene

ENSMUSG00000015357

Gene Name

caseinolytic mitochondrial matrix peptidase chaperone subunit

Synonyms

MMRRC Submission

038851-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0666 (G1)

Quality Score

159

Status

Validated

Chromosome

Chromosomal Location

65294260-65330658 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 65310225 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 25 (N25S)

Ref Sequence

ENSEMBL: ENSMUSP00000116377 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015501] [ENSMUST00000113824] [ENSMUST00000147279]

Predicted Effect

probably damaging
Transcript: ENSMUST00000015501
AA Change: N197S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000015501
Gene: ENSMUSG00000015357
AA Change: N197S

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	81	101	N/A	INTRINSIC
low complexity region	165	172	N/A	INTRINSIC
PDB:4I9K\|B	173	209	6e-7	PDB
low complexity region	259	268	N/A	INTRINSIC
AAA	286	437	1.64e-12	SMART
low complexity region	452	458	N/A	INTRINSIC
ClpB_D2-small	510	604	1.16e-29	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000113824
AA Change: N197S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109455
Gene: ENSMUSG00000015357
AA Change: N197S

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	81	101	N/A	INTRINSIC
low complexity region	165	172	N/A	INTRINSIC
low complexity region	245	254	N/A	INTRINSIC
AAA	272	423	1.64e-12	SMART
low complexity region	438	444	N/A	INTRINSIC
ClpB_D2-small	496	590	1.16e-29	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000147279
AA Change: N25S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116377
Gene: ENSMUSG00000015357
AA Change: N25S

Domain	Start	End	E-Value	Type
low complexity region	73	82	N/A	INTRINSIC
AAA	100	192	1.89e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148632

Meta Mutation Damage Score

0.7820

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 95.7%

Validation Efficiency

100% (89/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a protease found in mitochondria. This protease is ATP-dependent and targets specific proteins for degradation. The protease consists of two heptameric rings of the CLPP catalytic subunit sandwiched between two hexameric rings of the chaperone subunit encoded by this gene. Targeted proteins are unwound by this protein and then passed on to the CLPP subunit for degradation. Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	G	11: 78,287,987	M2026R	probably damaging	Het
2610507B11Rik	T	A	11: 78,277,212	L1491*	probably null	Het
Akap6	T	A	12: 52,911,808	V782E	probably damaging	Het
Atg9a	A	G	1: 75,185,090	L604P	probably damaging	Het
Atp1a3	T	C	7: 24,990,549	I482V	probably benign	Het
Ccdc105	C	A	10: 78,750,547	L223F	probably benign	Het
Ccdc18	T	G	5: 108,163,664	V412G	probably benign	Het
Cct6a	A	G	5: 129,794,386		noncoding transcript	Het
Cnpy2	T	A	10: 128,327,025	C171*	probably null	Het
Cntnap3	C	T	13: 64,757,397	D857N	probably damaging	Het
Col5a1	A	G	2: 28,032,685	Y255C	probably damaging	Het
Coro7	A	T	16: 4,631,911	F638Y	possibly damaging	Het
Cpd	A	G	11: 76,782,327	F1331L	probably damaging	Het
Csmd1	A	T	8: 16,069,049	I1842N	possibly damaging	Het
Dgkg	T	A	16: 22,562,730	D490V	probably damaging	Het
Dnah9	A	T	11: 66,085,458	M1255K	probably benign	Het
E2f1	A	G	2: 154,560,929	V306A	probably benign	Het
Entpd1	A	G	19: 40,659,906		probably benign	Het
Esrrb	T	A	12: 86,505,902	I222N	probably benign	Het
Fam159b	G	T	13: 104,858,354	T95K	possibly damaging	Het
Flt4	G	T	11: 49,625,447	A126S	possibly damaging	Het
Galnt11	C	T	5: 25,252,147	T237I	possibly damaging	Het
Gbf1	A	G	19: 46,262,544		probably benign	Het
Gm20388	A	T	8: 122,270,988		probably benign	Het
Gm7030	T	C	17: 36,127,834	T222A	possibly damaging	Het
Herc1	T	A	9: 66,484,888		probably benign	Het
Hsph1	T	C	5: 149,631,502	Y105C	probably damaging	Het
Il23r	T	C	6: 67,434,680	T358A	probably benign	Het
Il2ra	C	T	2: 11,643,073		probably benign	Het
Kbtbd4	G	T	2: 90,914,115		probably benign	Het
Kcnt1	A	G	2: 25,891,243		probably benign	Het
Kng2	A	G	16: 22,997,122		probably benign	Het
Lap3	C	T	5: 45,511,928	T473I	possibly damaging	Het
Lrrk2	T	C	15: 91,757,070		probably null	Het
Map1s	A	G	8: 70,914,052	N534D	possibly damaging	Het
Mtg1	G	A	7: 140,144,344	V122I	probably benign	Het
Myadm	T	A	7: 3,297,349	I209K	probably damaging	Het
Ntsr2	G	A	12: 16,653,980	V75I	probably benign	Het
Olfr1037	G	A	2: 86,085,213	A188V	probably benign	Het
Olfr1272	A	T	2: 90,281,868	S236T	probably damaging	Het
Pfn1	T	C	11: 70,654,366	T39A	probably benign	Het
Pipox	T	A	11: 77,883,825	K144M	probably benign	Het
Plekhh1	G	A	12: 79,069,115	E811K	probably damaging	Het
Pnpla3	T	A	15: 84,179,305	W295R	probably benign	Het
Prkacb	T	A	3: 146,751,518	T136S	probably damaging	Het
Ralbp1	T	A	17: 65,854,129	N473I	probably benign	Het
Rbp4	G	A	19: 38,118,460	T127M	probably damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rps3a1	G	A	3: 86,138,117		probably benign	Het
Scg3	G	T	9: 75,643,940	Y429*	probably null	Het
Spag5	T	C	11: 78,313,396	S492P	probably damaging	Het
St7	T	A	6: 17,934,239	M540K	probably damaging	Het
Stxbp3	C	A	3: 108,805,302	V281F	possibly damaging	Het
Sun5	A	G	2: 153,859,048	V242A	possibly damaging	Het
Susd5	G	T	9: 114,095,784	R245L	possibly damaging	Het
Syne2	A	G	12: 75,923,013	E954G	probably damaging	Het
Synpo2	A	T	3: 123,114,059	V536E	probably damaging	Het
Tas2r140	T	C	6: 133,055,442	I118V	probably benign	Het
Tbx18	C	A	9: 87,724,409	V228L	probably benign	Het
Tdrd9	T	A	12: 112,007,580		probably benign	Het
Tg	T	C	15: 66,737,521	M310T	probably benign	Het
Ticam2	T	A	18: 46,560,651	D123V	probably damaging	Het
Timm23	A	G	14: 32,199,036		probably benign	Het
Tinag	C	T	9: 77,005,687	R280H	probably benign	Het
Topbp1	G	A	9: 103,308,812	R51K	probably benign	Het
Tor1b	A	G	2: 30,953,913	I121V	probably damaging	Het
Tpmt	C	A	13: 47,032,454	G148V	probably damaging	Het
Tubb1	A	G	2: 174,457,755	E410G	probably damaging	Het
Ubash3b	C	A	9: 41,047,064	V7L	possibly damaging	Het
Ube2o	C	T	11: 116,542,835	E686K	probably damaging	Het
Unc13d	T	A	11: 116,069,492		probably benign	Het
Vmn1r183	A	T	7: 24,055,176	M135L	probably benign	Het
Wisp3	T	C	10: 39,151,289	R316G	probably benign	Het
Xkr8	T	C	4: 132,732,338	Y43C	probably damaging	Het
Zc3h4	T	A	7: 16,434,772	N935K	unknown	Het
Zc3h7a	G	A	16: 11,156,303		probably benign	Het
Zfp84	C	T	7: 29,776,851	H323Y	probably damaging	Het
Zfp873	G	T	10: 82,060,761	S442I	possibly damaging	Het
Zfp938	A	G	10: 82,225,772	L338P	probably damaging	Het

Other mutations in Clpx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00955:Clpx	APN	9	65324270	missense	probably damaging	1.00
IGL01394:Clpx	APN	9	65310213	missense	probably damaging	1.00
IGL01395:Clpx	APN	9	65301851	missense	probably benign	0.00
IGL01521:Clpx	APN	9	65318744	missense	probably damaging	1.00
IGL02141:Clpx	APN	9	65312118	splice site	probably null
IGL02512:Clpx	APN	9	65310251	missense	probably benign
IGL03008:Clpx	APN	9	65322775	missense	possibly damaging	0.76
IGL03146:Clpx	APN	9	65326830	missense	probably benign	0.01
IGL03152:Clpx	APN	9	65310176	missense	possibly damaging	0.56
IGL03309:Clpx	APN	9	65322692	missense	probably damaging	1.00
kneehigh	UTSW	9	65301879	nonsense	probably null
locust	UTSW	9	65324301	critical splice donor site	probably null
IGL02837:Clpx	UTSW	9	65324259	missense	probably damaging	1.00
R0167:Clpx	UTSW	9	65316737	missense	possibly damaging	0.53
R0399:Clpx	UTSW	9	65322769	missense	probably benign	0.03
R1386:Clpx	UTSW	9	65326888	missense	probably null	0.88
R1594:Clpx	UTSW	9	65324270	missense	probably damaging	0.99
R2038:Clpx	UTSW	9	65317493	missense	probably damaging	1.00
R4131:Clpx	UTSW	9	65316655	missense	possibly damaging	0.64
R4715:Clpx	UTSW	9	65312114	missense	possibly damaging	0.92
R5107:Clpx	UTSW	9	65308539	missense	possibly damaging	0.93
R5248:Clpx	UTSW	9	65320850	missense	probably damaging	1.00
R5520:Clpx	UTSW	9	65317448	nonsense	probably null
R5639:Clpx	UTSW	9	65329830	missense	probably benign	0.00
R5718:Clpx	UTSW	9	65299964	missense	probably benign
R6109:Clpx	UTSW	9	65299952	missense	probably benign	0.02
R6172:Clpx	UTSW	9	65301879	nonsense	probably null
R6173:Clpx	UTSW	9	65301879	nonsense	probably null
R6748:Clpx	UTSW	9	65310159	missense	probably benign	0.00
R7287:Clpx	UTSW	9	65300013	nonsense	probably null
R7409:Clpx	UTSW	9	65324247	missense	possibly damaging	0.94
R7806:Clpx	UTSW	9	65299931	missense	probably benign
R7814:Clpx	UTSW	9	65324301	critical splice donor site	probably null
R8212:Clpx	UTSW	9	65320891	missense	possibly damaging	0.46
R8753:Clpx	UTSW	9	65316676	missense	probably damaging	1.00
X0067:Clpx	UTSW	9	65316695	missense	possibly damaging	0.86
Z1177:Clpx	UTSW	9	65299997	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ctctccagccccAGACACTTCA -3'
(R):5'- GCTTCTCACACGCTTCCTAAAGAGAT -3'

Sequencing Primer
(F):5'- ccAGACACTTCATTTTTAATGGGAAC -3'
(R):5'- cacaaccatctgtaacaagacc -3'

Posted On

2013-07-30