Incidental Mutation 'R8070:0610040J01Rik'
ID 620217
Institutional Source Beutler Lab
Gene Symbol 0610040J01Rik
Ensembl Gene ENSMUSG00000060512
Gene Name RIKEN cDNA 0610040J01 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock # R8070 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 63812363-63899625 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 63898167 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 82 (E82G)
Ref Sequence ENSEMBL: ENSMUSP00000080443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081747] [ENSMUST00000196367] [ENSMUST00000196575] [ENSMUST00000199667]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000081747
AA Change: E82G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000080443
Gene: ENSMUSG00000060512
AA Change: E82G

DomainStartEndE-ValueType
Pfam:DUF4699 9 313 2.5e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196367
AA Change: E82G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000196575
AA Change: E82G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000199667
AA Change: E82G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik A G 17: 48,145,510 F86S probably damaging Het
Aamdc A T 7: 97,575,648 Y2* probably null Het
Acta1 T A 8: 123,893,621 D26V possibly damaging Het
Adra1d A C 2: 131,561,582 L196R probably damaging Het
Agbl2 G A 2: 90,791,565 C132Y probably benign Het
Amd1 A G 10: 40,294,230 V92A probably benign Het
Arid4b T A 13: 14,136,259 I149K probably benign Het
Atg7 A G 6: 114,697,080 M312V probably benign Het
Bap1 T A 14: 31,256,686 V381E probably damaging Het
Cbfa2t3 C T 8: 122,642,981 V207I possibly damaging Het
Cdh24 T C 14: 54,632,573 Q629R probably benign Het
Cdhr2 G T 13: 54,719,793 V479L probably benign Het
Chd2 A G 7: 73,451,758 S1407P probably benign Het
Clstn2 A G 9: 97,799,470 V39A possibly damaging Het
Cwh43 T A 5: 73,421,463 M357K possibly damaging Het
Dcdc2a T A 13: 25,202,197 D351E probably benign Het
Dennd6b T C 15: 89,185,373 I517V probably benign Het
Dnah17 T C 11: 118,024,671 E4374G probably damaging Het
Emsy A G 7: 98,626,715 S336P possibly damaging Het
Enoph1 A T 5: 100,060,982 E65D probably benign Het
Fam83f T A 15: 80,672,080 L55Q probably damaging Het
Fry T C 5: 150,478,007 F379L Het
Fscb A T 12: 64,474,608 M28K probably benign Het
Gas7 G A 11: 67,683,434 V412M probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gcn1l1 T A 5: 115,588,998 V638E probably benign Het
Ggt1 A T 10: 75,578,899 I184F probably damaging Het
Gigyf2 A G 1: 87,440,907 N1103S probably benign Het
Gm13757 G T 2: 88,446,659 T93K probably benign Het
Gm5592 G A 7: 41,286,463 A130T possibly damaging Het
Gys2 T C 6: 142,448,504 probably null Het
Hmcn1 C A 1: 150,649,992 E3327* probably null Het
Ighv1-36 C T 12: 114,880,036 G68E probably damaging Het
Igkv6-32 G A 6: 70,074,105 T89M probably damaging Het
Ipo7 A G 7: 110,052,807 D931G probably benign Het
Jakmip1 A G 5: 37,173,287 E437G probably benign Het
Lingo3 C T 10: 80,836,121 probably benign Het
Lnpep A G 17: 17,538,638 S815P probably damaging Het
Ly6a T C 15: 74,997,600 D2G probably damaging Het
Madd C A 2: 91,158,014 E1223* probably null Het
Mapk8ip3 A T 17: 24,901,104 probably null Het
Mecom T C 3: 29,979,838 E239G probably damaging Het
Mug1 T C 6: 121,875,879 V889A probably benign Het
Myo18b T A 5: 112,791,120 N1675I probably benign Het
Ndrg4 T C 8: 95,700,128 F50L possibly damaging Het
Ndst4 A G 3: 125,714,644 Y286C probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfm3 A G 3: 115,101,955 D195G probably damaging Het
Olfr1384 A T 11: 49,514,114 T159S probably damaging Het
Pds5a A G 5: 65,652,398 L407P possibly damaging Het
Pgm1 A G 5: 64,112,082 N504S probably benign Het
Plce1 A G 19: 38,701,839 M656V probably damaging Het
Pou6f2 T C 13: 18,239,624 T189A unknown Het
Ppp1r12b T C 1: 134,876,069 S451G probably benign Het
Prox1 T G 1: 190,160,910 N446T probably damaging Het
Ralgapa2 T A 2: 146,353,279 R1195S probably damaging Het
Rere A G 4: 150,617,375 D37G probably damaging Het
Tfip11 T A 5: 112,334,930 M560K possibly damaging Het
Thop1 T C 10: 81,079,486 V260A probably damaging Het
Tle6 A G 10: 81,598,642 M41T possibly damaging Het
Trav13-4-dv7 T C 14: 53,757,792 S68P possibly damaging Het
Trim24 A G 6: 37,957,726 N826S probably damaging Het
Tuba3a T C 6: 125,278,470 E414G probably damaging Het
Vmn2r78 A G 7: 86,922,487 I502V probably benign Het
Vmn2r79 A T 7: 87,002,128 Y245F probably benign Het
Other mutations in 0610040J01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:0610040J01Rik APN 5 63898383 missense possibly damaging 0.79
IGL02229:0610040J01Rik APN 5 63898353 missense probably damaging 0.99
IGL02389:0610040J01Rik APN 5 63896483 missense probably null 1.00
IGL02411:0610040J01Rik APN 5 63898116 missense probably benign 0.31
R0243:0610040J01Rik UTSW 5 63898463 missense probably benign 0.10
R0411:0610040J01Rik UTSW 5 63896491 splice site probably benign
R1978:0610040J01Rik UTSW 5 63898537 nonsense probably null
R2072:0610040J01Rik UTSW 5 63898737 missense possibly damaging 0.83
R2202:0610040J01Rik UTSW 5 63898668 missense possibly damaging 0.91
R3161:0610040J01Rik UTSW 5 63896490 splice site probably benign
R3162:0610040J01Rik UTSW 5 63896490 splice site probably benign
R4428:0610040J01Rik UTSW 5 63898839 unclassified probably benign
R4429:0610040J01Rik UTSW 5 63898839 unclassified probably benign
R4430:0610040J01Rik UTSW 5 63898839 unclassified probably benign
R4431:0610040J01Rik UTSW 5 63898839 unclassified probably benign
R4464:0610040J01Rik UTSW 5 63898839 unclassified probably benign
R4465:0610040J01Rik UTSW 5 63898839 unclassified probably benign
R4467:0610040J01Rik UTSW 5 63898839 unclassified probably benign
R4491:0610040J01Rik UTSW 5 63898469 missense probably damaging 1.00
R5161:0610040J01Rik UTSW 5 63898001 nonsense probably null
R6115:0610040J01Rik UTSW 5 63897974 missense probably damaging 1.00
R6273:0610040J01Rik UTSW 5 63898218 missense probably damaging 1.00
R7445:0610040J01Rik UTSW 5 63898619 missense probably damaging 0.99
R7593:0610040J01Rik UTSW 5 63898431 missense probably damaging 0.97
R8140:0610040J01Rik UTSW 5 63898611 missense possibly damaging 0.83
R8165:0610040J01Rik UTSW 5 63897946 splice site probably null
R8557:0610040J01Rik UTSW 5 63898611 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGATCCAGTTCAAGTGCCCTC -3'
(R):5'- GGCAGCTTTGCTTCCTGTAGTC -3'

Sequencing Primer
(F):5'- CGCCTGGTTTTGTCAATGAAGTAAAC -3'
(R):5'- CCTGTAGTCTTCTCCTTCAAGG -3'
Posted On 2020-01-23