Incidental Mutation 'R8070:Pgm1'
ID620218
Institutional Source Beutler Lab
Gene Symbol Pgm1
Ensembl Gene ENSMUSG00000029171
Gene Namephosphoglucomutase 1
SynonymsPgm-1, 3230402E02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8070 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location64092950-64128351 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64112082 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 504 (N504S)
Ref Sequence ENSEMBL: ENSMUSP00000084582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087324]
Predicted Effect probably benign
Transcript: ENSMUST00000087324
AA Change: N504S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000084582
Gene: ENSMUSG00000029171
AA Change: N504S

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:PGM_PMM_I 62 211 7.8e-37 PFAM
Pfam:PGM_PMM_II 235 344 1.9e-25 PFAM
Pfam:PGM_PMM_III 351 480 4.6e-15 PFAM
Pfam:PGM_PMM_IV 523 603 5.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197577
Predicted Effect probably benign
Transcript: ENSMUST00000199093
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Four electrophoretic variants are known, each with a 5-band pattern: the a allele in C57BL/6, BALB/c and AKR; b allele in DBA/2 and SJL; c allele in C3H/He; and d allele in 129/Re. Heterozygotes show a mixture of bands. Mice homozygous for a spontaneous null allele or ENU induced alleles are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik A G 5: 63,898,167 E82G probably benign Het
9830107B12Rik A G 17: 48,145,510 F86S probably damaging Het
Aamdc A T 7: 97,575,648 Y2* probably null Het
Acta1 T A 8: 123,893,621 D26V possibly damaging Het
Adra1d A C 2: 131,561,582 L196R probably damaging Het
Agbl2 G A 2: 90,791,565 C132Y probably benign Het
Amd1 A G 10: 40,294,230 V92A probably benign Het
Arid4b T A 13: 14,136,259 I149K probably benign Het
Atg7 A G 6: 114,697,080 M312V probably benign Het
Bap1 T A 14: 31,256,686 V381E probably damaging Het
Cbfa2t3 C T 8: 122,642,981 V207I possibly damaging Het
Cdh24 T C 14: 54,632,573 Q629R probably benign Het
Cdhr2 G T 13: 54,719,793 V479L probably benign Het
Chd2 A G 7: 73,451,758 S1407P probably benign Het
Clstn2 A G 9: 97,799,470 V39A possibly damaging Het
Cwh43 T A 5: 73,421,463 M357K possibly damaging Het
Dcdc2a T A 13: 25,202,197 D351E probably benign Het
Dennd6b T C 15: 89,185,373 I517V probably benign Het
Dnah17 T C 11: 118,024,671 E4374G probably damaging Het
Emsy A G 7: 98,626,715 S336P possibly damaging Het
Enoph1 A T 5: 100,060,982 E65D probably benign Het
Fam83f T A 15: 80,672,080 L55Q probably damaging Het
Fry T C 5: 150,478,007 F379L Het
Fscb A T 12: 64,474,608 M28K probably benign Het
Gas7 G A 11: 67,683,434 V412M probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gcn1l1 T A 5: 115,588,998 V638E probably benign Het
Ggt1 A T 10: 75,578,899 I184F probably damaging Het
Gigyf2 A G 1: 87,440,907 N1103S probably benign Het
Gm13757 G T 2: 88,446,659 T93K probably benign Het
Gm5592 G A 7: 41,286,463 A130T possibly damaging Het
Gys2 T C 6: 142,448,504 probably null Het
Hmcn1 C A 1: 150,649,992 E3327* probably null Het
Ighv1-36 C T 12: 114,880,036 G68E probably damaging Het
Igkv6-32 G A 6: 70,074,105 T89M probably damaging Het
Ipo7 A G 7: 110,052,807 D931G probably benign Het
Jakmip1 A G 5: 37,173,287 E437G probably benign Het
Lingo3 C T 10: 80,836,121 probably benign Het
Lnpep A G 17: 17,538,638 S815P probably damaging Het
Ly6a T C 15: 74,997,600 D2G probably damaging Het
Madd C A 2: 91,158,014 E1223* probably null Het
Mapk8ip3 A T 17: 24,901,104 probably null Het
Mecom T C 3: 29,979,838 E239G probably damaging Het
Mug1 T C 6: 121,875,879 V889A probably benign Het
Myo18b T A 5: 112,791,120 N1675I probably benign Het
Ndrg4 T C 8: 95,700,128 F50L possibly damaging Het
Ndst4 A G 3: 125,714,644 Y286C probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfm3 A G 3: 115,101,955 D195G probably damaging Het
Olfr1384 A T 11: 49,514,114 T159S probably damaging Het
Pds5a A G 5: 65,652,398 L407P possibly damaging Het
Plce1 A G 19: 38,701,839 M656V probably damaging Het
Pou6f2 T C 13: 18,239,624 T189A unknown Het
Ppp1r12b T C 1: 134,876,069 S451G probably benign Het
Prox1 T G 1: 190,160,910 N446T probably damaging Het
Ralgapa2 T A 2: 146,353,279 R1195S probably damaging Het
Rere A G 4: 150,617,375 D37G probably damaging Het
Tfip11 T A 5: 112,334,930 M560K possibly damaging Het
Thop1 T C 10: 81,079,486 V260A probably damaging Het
Tle6 A G 10: 81,598,642 M41T possibly damaging Het
Trav13-4-dv7 T C 14: 53,757,792 S68P possibly damaging Het
Trim24 A G 6: 37,957,726 N826S probably damaging Het
Tuba3a T C 6: 125,278,470 E414G probably damaging Het
Vmn2r78 A G 7: 86,922,487 I502V probably benign Het
Vmn2r79 A T 7: 87,002,128 Y245F probably benign Het
Other mutations in Pgm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Pgm1 APN 5 64108269 splice site probably benign
IGL01068:Pgm1 APN 5 64107796 missense probably damaging 0.99
IGL01112:Pgm1 APN 5 64102882 missense possibly damaging 0.86
IGL01634:Pgm1 APN 5 64100974 missense probably benign 0.01
IGL02513:Pgm1 APN 5 64102946 unclassified probably benign
R0255:Pgm1 UTSW 5 64112043 missense possibly damaging 0.93
R0268:Pgm1 UTSW 5 64105808 missense probably damaging 1.00
R0511:Pgm1 UTSW 5 64110555 missense probably damaging 1.00
R0722:Pgm1 UTSW 5 64107679 nonsense probably null
R0881:Pgm1 UTSW 5 64093008 missense unknown
R0924:Pgm1 UTSW 5 64112147 missense possibly damaging 0.90
R0930:Pgm1 UTSW 5 64112147 missense possibly damaging 0.90
R1773:Pgm1 UTSW 5 64107851 critical splice donor site probably null
R1777:Pgm1 UTSW 5 64127782 missense probably benign
R2137:Pgm1 UTSW 5 64116366 missense probably benign
R2244:Pgm1 UTSW 5 64106702 missense probably benign 0.00
R3946:Pgm1 UTSW 5 64112061 missense probably benign
R4301:Pgm1 UTSW 5 64103797 nonsense probably null
R4601:Pgm1 UTSW 5 64107727 missense probably benign 0.02
R4631:Pgm1 UTSW 5 64105947 splice site probably null
R4795:Pgm1 UTSW 5 64103874 missense probably damaging 1.00
R4871:Pgm1 UTSW 5 64103894 missense probably benign
R4893:Pgm1 UTSW 5 64105940 missense probably benign
R4907:Pgm1 UTSW 5 64103878 missense probably benign 0.00
R4915:Pgm1 UTSW 5 64100948 missense probably damaging 1.00
R5092:Pgm1 UTSW 5 64107749 missense possibly damaging 0.49
R5197:Pgm1 UTSW 5 64105832 missense possibly damaging 0.87
R5621:Pgm1 UTSW 5 64112038 nonsense probably null
R6311:Pgm1 UTSW 5 64116415 missense probably benign 0.05
R6651:Pgm1 UTSW 5 64112094 missense probably benign 0.07
R6731:Pgm1 UTSW 5 64100975 missense probably benign 0.27
R6885:Pgm1 UTSW 5 64103878 missense probably benign 0.00
R6919:Pgm1 UTSW 5 64097025 missense probably benign 0.11
R7211:Pgm1 UTSW 5 64105850 missense probably damaging 0.99
R7631:Pgm1 UTSW 5 64108179 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGGTTAGAGTTCCCTGTTTCAC -3'
(R):5'- GCCTGAATTTTCAATCAACCATGG -3'

Sequencing Primer
(F):5'- AGTTCCCTGTTTCACTCACTTTAGAG -3'
(R):5'- TCTATTCAAATGGTAGGCAATGGTG -3'
Posted On2020-01-23