Incidental Mutation 'R8070:Ipo7'
ID620238
Institutional Source Beutler Lab
Gene Symbol Ipo7
Ensembl Gene ENSMUSG00000066232
Gene Nameimportin 7
SynonymsA330055O14Rik, Imp7, RanBP7
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R8070 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location110018274-110056609 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110052807 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 931 (D931G)
Ref Sequence ENSEMBL: ENSMUSP00000081782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084731] [ENSMUST00000208951]
Predicted Effect probably benign
Transcript: ENSMUST00000084731
AA Change: D931G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000081782
Gene: ENSMUSG00000066232
AA Change: D931G

DomainStartEndE-ValueType
IBN_N 22 101 3.06e-15 SMART
Pfam:Cse1 168 452 2.8e-12 PFAM
low complexity region 701 712 N/A INTRINSIC
low complexity region 881 900 N/A INTRINSIC
low complexity region 923 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208951
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The importin-alpha/beta complex and the GTPase Ran mediate nuclear import of proteins with a classical nuclear localization signal. The protein encoded by this gene is a member of a class of approximately 20 potential Ran targets that share a sequence motif related to the Ran-binding site of importin-beta. Similar to importin-beta, this protein prevents the activation of Ran's GTPase by RanGAP1 and inhibits nucleotide exchange on RanGTP, and also binds directly to nuclear pore complexes where it competes for binding sites with importin-beta and transportin. This protein has a Ran-dependent transport cycle and it can cross the nuclear envelope rapidly and in both directions. At least four importin beta-like transport receptors, namely importin beta itself, transportin, RanBP5 and RanBP7, directly bind and import ribosomal proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik A G 5: 63,898,167 E82G probably benign Het
9830107B12Rik A G 17: 48,145,510 F86S probably damaging Het
Aamdc A T 7: 97,575,648 Y2* probably null Het
Acta1 T A 8: 123,893,621 D26V possibly damaging Het
Adra1d A C 2: 131,561,582 L196R probably damaging Het
Agbl2 G A 2: 90,791,565 C132Y probably benign Het
Amd1 A G 10: 40,294,230 V92A probably benign Het
Arid4b T A 13: 14,136,259 I149K probably benign Het
Atg7 A G 6: 114,697,080 M312V probably benign Het
Bap1 T A 14: 31,256,686 V381E probably damaging Het
Cbfa2t3 C T 8: 122,642,981 V207I possibly damaging Het
Cdh24 T C 14: 54,632,573 Q629R probably benign Het
Cdhr2 G T 13: 54,719,793 V479L probably benign Het
Chd2 A G 7: 73,451,758 S1407P probably benign Het
Clstn2 A G 9: 97,799,470 V39A possibly damaging Het
Cwh43 T A 5: 73,421,463 M357K possibly damaging Het
Dcdc2a T A 13: 25,202,197 D351E probably benign Het
Dennd6b T C 15: 89,185,373 I517V probably benign Het
Dnah17 T C 11: 118,024,671 E4374G probably damaging Het
Emsy A G 7: 98,626,715 S336P possibly damaging Het
Enoph1 A T 5: 100,060,982 E65D probably benign Het
Fam83f T A 15: 80,672,080 L55Q probably damaging Het
Fry T C 5: 150,478,007 F379L Het
Fscb A T 12: 64,474,608 M28K probably benign Het
Gas7 G A 11: 67,683,434 V412M probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gcn1l1 T A 5: 115,588,998 V638E probably benign Het
Ggt1 A T 10: 75,578,899 I184F probably damaging Het
Gigyf2 A G 1: 87,440,907 N1103S probably benign Het
Gm13757 G T 2: 88,446,659 T93K probably benign Het
Gm5592 G A 7: 41,286,463 A130T possibly damaging Het
Gys2 T C 6: 142,448,504 probably null Het
Hmcn1 C A 1: 150,649,992 E3327* probably null Het
Ighv1-36 C T 12: 114,880,036 G68E probably damaging Het
Igkv6-32 G A 6: 70,074,105 T89M probably damaging Het
Jakmip1 A G 5: 37,173,287 E437G probably benign Het
Lingo3 C T 10: 80,836,121 probably benign Het
Lnpep A G 17: 17,538,638 S815P probably damaging Het
Ly6a T C 15: 74,997,600 D2G probably damaging Het
Madd C A 2: 91,158,014 E1223* probably null Het
Mapk8ip3 A T 17: 24,901,104 probably null Het
Mecom T C 3: 29,979,838 E239G probably damaging Het
Mug1 T C 6: 121,875,879 V889A probably benign Het
Myo18b T A 5: 112,791,120 N1675I probably benign Het
Ndrg4 T C 8: 95,700,128 F50L possibly damaging Het
Ndst4 A G 3: 125,714,644 Y286C probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfm3 A G 3: 115,101,955 D195G probably damaging Het
Olfr1384 A T 11: 49,514,114 T159S probably damaging Het
Pds5a A G 5: 65,652,398 L407P possibly damaging Het
Pgm1 A G 5: 64,112,082 N504S probably benign Het
Plce1 A G 19: 38,701,839 M656V probably damaging Het
Pou6f2 T C 13: 18,239,624 T189A unknown Het
Ppp1r12b T C 1: 134,876,069 S451G probably benign Het
Prox1 T G 1: 190,160,910 N446T probably damaging Het
Ralgapa2 T A 2: 146,353,279 R1195S probably damaging Het
Rere A G 4: 150,617,375 D37G probably damaging Het
Tfip11 T A 5: 112,334,930 M560K possibly damaging Het
Thop1 T C 10: 81,079,486 V260A probably damaging Het
Tle6 A G 10: 81,598,642 M41T possibly damaging Het
Trav13-4-dv7 T C 14: 53,757,792 S68P possibly damaging Het
Trim24 A G 6: 37,957,726 N826S probably damaging Het
Tuba3a T C 6: 125,278,470 E414G probably damaging Het
Vmn2r78 A G 7: 86,922,487 I502V probably benign Het
Vmn2r79 A T 7: 87,002,128 Y245F probably benign Het
Other mutations in Ipo7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:Ipo7 APN 7 110029848 intron probably benign
IGL02472:Ipo7 APN 7 110040853 missense probably damaging 1.00
IGL02502:Ipo7 APN 7 110051050 missense probably damaging 1.00
IGL02514:Ipo7 APN 7 110048828 missense possibly damaging 0.78
IGL02535:Ipo7 APN 7 110054026 missense probably damaging 0.98
IGL02961:Ipo7 APN 7 110047016 missense probably benign 0.02
R0089:Ipo7 UTSW 7 110050765 intron probably benign
R0355:Ipo7 UTSW 7 110049661 missense probably benign 0.00
R0565:Ipo7 UTSW 7 110049593 intron probably benign
R1342:Ipo7 UTSW 7 110029804 missense possibly damaging 0.82
R1405:Ipo7 UTSW 7 110029841 missense probably benign 0.03
R1405:Ipo7 UTSW 7 110039249 missense probably damaging 0.97
R1405:Ipo7 UTSW 7 110029841 missense probably benign 0.03
R1405:Ipo7 UTSW 7 110039249 missense probably damaging 0.97
R1791:Ipo7 UTSW 7 110027132 missense probably damaging 0.98
R1838:Ipo7 UTSW 7 110042109 missense probably damaging 1.00
R2116:Ipo7 UTSW 7 110051118 missense probably damaging 0.99
R2120:Ipo7 UTSW 7 110049631 missense probably damaging 1.00
R4366:Ipo7 UTSW 7 110029712 missense possibly damaging 0.58
R4366:Ipo7 UTSW 7 110048216 missense possibly damaging 0.88
R4805:Ipo7 UTSW 7 110051484 missense probably benign 0.16
R5228:Ipo7 UTSW 7 110046762 missense probably benign 0.00
R5903:Ipo7 UTSW 7 110050813 missense probably damaging 1.00
R5976:Ipo7 UTSW 7 110048807 missense probably damaging 1.00
R6254:Ipo7 UTSW 7 110049060 missense probably benign 0.00
R6335:Ipo7 UTSW 7 110018468 missense possibly damaging 0.92
R6360:Ipo7 UTSW 7 110027129 missense probably damaging 1.00
R6776:Ipo7 UTSW 7 110047065 missense probably damaging 0.98
R7132:Ipo7 UTSW 7 110054047 missense probably benign 0.17
R7329:Ipo7 UTSW 7 110049017 missense possibly damaging 0.94
R7491:Ipo7 UTSW 7 110039194 missense possibly damaging 0.91
R7763:Ipo7 UTSW 7 110052799 missense possibly damaging 0.62
RF017:Ipo7 UTSW 7 110048794 missense probably benign 0.00
X0062:Ipo7 UTSW 7 110052886 missense probably damaging 1.00
X0066:Ipo7 UTSW 7 110052734 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACACCTGTGAGTGGTATTTTATTCC -3'
(R):5'- TGCTTCACTTCTTGTCTAAGGG -3'

Sequencing Primer
(F):5'- TGGTATTTTATTCCTGGAACTGTTC -3'
(R):5'- GATTTGATACTCATCAACAGG -3'
Posted On2020-01-23