Incidental Mutation 'R8070:Ndrg4'
ID620239
Institutional Source Beutler Lab
Gene Symbol Ndrg4
Ensembl Gene ENSMUSG00000036564
Gene NameN-myc downstream regulated gene 4
SynonymsD8Bwg1337e, Ndr1-rs, SMAP-8, Ndr4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8070 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location95676980-95715119 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95700128 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 50 (F50L)
Ref Sequence ENSEMBL: ENSMUSP00000036226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041318] [ENSMUST00000073139] [ENSMUST00000080666] [ENSMUST00000160964] [ENSMUST00000166358] [ENSMUST00000212160]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041318
AA Change: F50L

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000036226
Gene: ENSMUSG00000036564
AA Change: F50L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Ndr 60 342 3.1e-126 PFAM
low complexity region 360 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073139
SMART Domains Protein: ENSMUSP00000072883
Gene: ENSMUSG00000036564

DomainStartEndE-ValueType
Pfam:Ndr 8 290 2e-126 PFAM
Pfam:Abhydrolase_6 43 278 1.2e-16 PFAM
low complexity region 308 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080666
SMART Domains Protein: ENSMUSP00000079495
Gene: ENSMUSG00000036564

DomainStartEndE-ValueType
Pfam:Ndr 8 290 9.9e-127 PFAM
Pfam:Abhydrolase_6 43 278 1.1e-16 PFAM
low complexity region 295 310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160964
AA Change: F30L

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000125703
Gene: ENSMUSG00000036564
AA Change: F30L

DomainStartEndE-ValueType
Pfam:Ndr 40 225 6.8e-85 PFAM
Pfam:Abhydrolase_6 75 223 5.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166358
AA Change: F50L

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000131203
Gene: ENSMUSG00000036564
AA Change: F50L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212160
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein that is required for cell cycle progression and survival in primary astrocytes and may be involved in the regulation of mitogenic signalling in vascular smooth muscles cells. Alternative splicing results in multiple transcripts encoding different isoforms.[provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spatial learning deficits and increased susceptibility to ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik A G 5: 63,898,167 E82G probably benign Het
9830107B12Rik A G 17: 48,145,510 F86S probably damaging Het
Aamdc A T 7: 97,575,648 Y2* probably null Het
Acta1 T A 8: 123,893,621 D26V possibly damaging Het
Adra1d A C 2: 131,561,582 L196R probably damaging Het
Agbl2 G A 2: 90,791,565 C132Y probably benign Het
Amd1 A G 10: 40,294,230 V92A probably benign Het
Arid4b T A 13: 14,136,259 I149K probably benign Het
Atg7 A G 6: 114,697,080 M312V probably benign Het
Bap1 T A 14: 31,256,686 V381E probably damaging Het
Cbfa2t3 C T 8: 122,642,981 V207I possibly damaging Het
Cdh24 T C 14: 54,632,573 Q629R probably benign Het
Cdhr2 G T 13: 54,719,793 V479L probably benign Het
Chd2 A G 7: 73,451,758 S1407P probably benign Het
Clstn2 A G 9: 97,799,470 V39A possibly damaging Het
Cwh43 T A 5: 73,421,463 M357K possibly damaging Het
Dcdc2a T A 13: 25,202,197 D351E probably benign Het
Dennd6b T C 15: 89,185,373 I517V probably benign Het
Dnah17 T C 11: 118,024,671 E4374G probably damaging Het
Emsy A G 7: 98,626,715 S336P possibly damaging Het
Enoph1 A T 5: 100,060,982 E65D probably benign Het
Fam83f T A 15: 80,672,080 L55Q probably damaging Het
Fry T C 5: 150,478,007 F379L Het
Fscb A T 12: 64,474,608 M28K probably benign Het
Gas7 G A 11: 67,683,434 V412M probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gcn1l1 T A 5: 115,588,998 V638E probably benign Het
Ggt1 A T 10: 75,578,899 I184F probably damaging Het
Gigyf2 A G 1: 87,440,907 N1103S probably benign Het
Gm13757 G T 2: 88,446,659 T93K probably benign Het
Gm5592 G A 7: 41,286,463 A130T possibly damaging Het
Gys2 T C 6: 142,448,504 probably null Het
Hmcn1 C A 1: 150,649,992 E3327* probably null Het
Ighv1-36 C T 12: 114,880,036 G68E probably damaging Het
Igkv6-32 G A 6: 70,074,105 T89M probably damaging Het
Ipo7 A G 7: 110,052,807 D931G probably benign Het
Jakmip1 A G 5: 37,173,287 E437G probably benign Het
Lingo3 C T 10: 80,836,121 probably benign Het
Lnpep A G 17: 17,538,638 S815P probably damaging Het
Ly6a T C 15: 74,997,600 D2G probably damaging Het
Madd C A 2: 91,158,014 E1223* probably null Het
Mapk8ip3 A T 17: 24,901,104 probably null Het
Mecom T C 3: 29,979,838 E239G probably damaging Het
Mug1 T C 6: 121,875,879 V889A probably benign Het
Myo18b T A 5: 112,791,120 N1675I probably benign Het
Ndst4 A G 3: 125,714,644 Y286C probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfm3 A G 3: 115,101,955 D195G probably damaging Het
Olfr1384 A T 11: 49,514,114 T159S probably damaging Het
Pds5a A G 5: 65,652,398 L407P possibly damaging Het
Pgm1 A G 5: 64,112,082 N504S probably benign Het
Plce1 A G 19: 38,701,839 M656V probably damaging Het
Pou6f2 T C 13: 18,239,624 T189A unknown Het
Ppp1r12b T C 1: 134,876,069 S451G probably benign Het
Prox1 T G 1: 190,160,910 N446T probably damaging Het
Ralgapa2 T A 2: 146,353,279 R1195S probably damaging Het
Rere A G 4: 150,617,375 D37G probably damaging Het
Tfip11 T A 5: 112,334,930 M560K possibly damaging Het
Thop1 T C 10: 81,079,486 V260A probably damaging Het
Tle6 A G 10: 81,598,642 M41T possibly damaging Het
Trav13-4-dv7 T C 14: 53,757,792 S68P possibly damaging Het
Trim24 A G 6: 37,957,726 N826S probably damaging Het
Tuba3a T C 6: 125,278,470 E414G probably damaging Het
Vmn2r78 A G 7: 86,922,487 I502V probably benign Het
Vmn2r79 A T 7: 87,002,128 Y245F probably benign Het
Other mutations in Ndrg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01504:Ndrg4 APN 8 95706266 missense probably damaging 1.00
IGL01832:Ndrg4 APN 8 95713319 missense probably damaging 1.00
R0325:Ndrg4 UTSW 8 95710935 missense probably damaging 1.00
R1710:Ndrg4 UTSW 8 95710686 missense probably damaging 1.00
R1716:Ndrg4 UTSW 8 95712328 missense probably benign 0.00
R2393:Ndrg4 UTSW 8 95706211 nonsense probably null
R2897:Ndrg4 UTSW 8 95678386 splice site probably null
R2898:Ndrg4 UTSW 8 95678386 splice site probably null
R5838:Ndrg4 UTSW 8 95706793 missense probably damaging 1.00
R6264:Ndrg4 UTSW 8 95709768 missense probably damaging 0.99
R6893:Ndrg4 UTSW 8 95706601 nonsense probably null
Z1177:Ndrg4 UTSW 8 95710961 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCTCCCCGTTAACCCAGAAG -3'
(R):5'- TGTTCACAGAGGGTCCAACC -3'

Sequencing Primer
(F):5'- GATAGAAATCCTTGCACCGGGTAAC -3'
(R):5'- GGTCCAACCCCTTCACTGG -3'
Posted On2020-01-23