Incidental Mutation 'R8070:Cbfa2t3'
ID620240
Institutional Source Beutler Lab
Gene Symbol Cbfa2t3
Ensembl Gene ENSMUSG00000006362
Gene Namecore-binding factor, runt domain, alpha subunit 2, translocated to, 3 (human)
SynonymsMTGR2, ETO-2, Eto2, A630044F12Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8070 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location122625141-122699109 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 122642981 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 207 (V207I)
Ref Sequence ENSEMBL: ENSMUSP00000118997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006525] [ENSMUST00000064674] [ENSMUST00000127664] [ENSMUST00000127984] [ENSMUST00000134045]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006525
AA Change: V146I

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000006525
Gene: ENSMUSG00000006362
AA Change: V146I

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
TAFH 87 177 5.46e-52 SMART
low complexity region 248 257 N/A INTRINSIC
Pfam:NHR2 295 361 3.6e-41 PFAM
PDB:2KYG|C 395 424 3e-10 PDB
Pfam:zf-MYND 472 508 2.6e-10 PFAM
low complexity region 529 552 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000064674
AA Change: V172I

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000065728
Gene: ENSMUSG00000006362
AA Change: V172I

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
TAFH 113 203 5.46e-52 SMART
low complexity region 274 283 N/A INTRINSIC
Pfam:NHR2 321 387 7.1e-41 PFAM
PDB:2KYG|C 421 450 1e-10 PDB
Pfam:zf-MYND 498 534 7.1e-10 PFAM
low complexity region 555 578 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000127984
AA Change: V207I

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118997
Gene: ENSMUSG00000006362
AA Change: V207I

DomainStartEndE-ValueType
low complexity region 47 62 N/A INTRINSIC
TAFH 148 238 5.46e-52 SMART
low complexity region 309 318 N/A INTRINSIC
Pfam:NHR2 356 422 2.3e-38 PFAM
PDB:2KYG|C 456 485 2e-10 PDB
Pfam:zf-MYND 533 569 6.9e-10 PFAM
low complexity region 590 613 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000134045
AA Change: V172I

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117630
Gene: ENSMUSG00000006362
AA Change: V172I

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
Pfam:TAFH 111 185 3.7e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myeloid translocation gene family which interact with DNA-bound transcription factors and recruit a range of corepressors to facilitate transcriptional repression. The t(16;21)(q24;q22) translocation is one of the less common karyotypic abnormalities in acute myeloid leukemia. The translocation produces a chimeric gene made up of the 5'-region of the runt-related transcription factor 1 gene fused to the 3'-region of this gene. This gene is also a putative breast tumor suppressor. Alternative splicing results in transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice that are homozygote null for this gene display skewing of the early myeloid progenitor cells toward the granulocytic/macrophage lineage while reducing the numbers of megakaryocyte-erythroid progenitor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik A G 5: 63,898,167 E82G probably benign Het
9830107B12Rik A G 17: 48,145,510 F86S probably damaging Het
Aamdc A T 7: 97,575,648 Y2* probably null Het
Acta1 T A 8: 123,893,621 D26V possibly damaging Het
Adra1d A C 2: 131,561,582 L196R probably damaging Het
Agbl2 G A 2: 90,791,565 C132Y probably benign Het
Amd1 A G 10: 40,294,230 V92A probably benign Het
Arid4b T A 13: 14,136,259 I149K probably benign Het
Atg7 A G 6: 114,697,080 M312V probably benign Het
Bap1 T A 14: 31,256,686 V381E probably damaging Het
Cdh24 T C 14: 54,632,573 Q629R probably benign Het
Cdhr2 G T 13: 54,719,793 V479L probably benign Het
Chd2 A G 7: 73,451,758 S1407P probably benign Het
Clstn2 A G 9: 97,799,470 V39A possibly damaging Het
Cwh43 T A 5: 73,421,463 M357K possibly damaging Het
Dcdc2a T A 13: 25,202,197 D351E probably benign Het
Dennd6b T C 15: 89,185,373 I517V probably benign Het
Dnah17 T C 11: 118,024,671 E4374G probably damaging Het
Emsy A G 7: 98,626,715 S336P possibly damaging Het
Enoph1 A T 5: 100,060,982 E65D probably benign Het
Fam83f T A 15: 80,672,080 L55Q probably damaging Het
Fry T C 5: 150,478,007 F379L Het
Fscb A T 12: 64,474,608 M28K probably benign Het
Gas7 G A 11: 67,683,434 V412M probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gcn1l1 T A 5: 115,588,998 V638E probably benign Het
Ggt1 A T 10: 75,578,899 I184F probably damaging Het
Gigyf2 A G 1: 87,440,907 N1103S probably benign Het
Gm13757 G T 2: 88,446,659 T93K probably benign Het
Gm5592 G A 7: 41,286,463 A130T possibly damaging Het
Gys2 T C 6: 142,448,504 probably null Het
Hmcn1 C A 1: 150,649,992 E3327* probably null Het
Ighv1-36 C T 12: 114,880,036 G68E probably damaging Het
Igkv6-32 G A 6: 70,074,105 T89M probably damaging Het
Ipo7 A G 7: 110,052,807 D931G probably benign Het
Jakmip1 A G 5: 37,173,287 E437G probably benign Het
Lingo3 C T 10: 80,836,121 probably benign Het
Lnpep A G 17: 17,538,638 S815P probably damaging Het
Ly6a T C 15: 74,997,600 D2G probably damaging Het
Madd C A 2: 91,158,014 E1223* probably null Het
Mapk8ip3 A T 17: 24,901,104 probably null Het
Mecom T C 3: 29,979,838 E239G probably damaging Het
Mug1 T C 6: 121,875,879 V889A probably benign Het
Myo18b T A 5: 112,791,120 N1675I probably benign Het
Ndrg4 T C 8: 95,700,128 F50L possibly damaging Het
Ndst4 A G 3: 125,714,644 Y286C probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfm3 A G 3: 115,101,955 D195G probably damaging Het
Olfr1384 A T 11: 49,514,114 T159S probably damaging Het
Pds5a A G 5: 65,652,398 L407P possibly damaging Het
Pgm1 A G 5: 64,112,082 N504S probably benign Het
Plce1 A G 19: 38,701,839 M656V probably damaging Het
Pou6f2 T C 13: 18,239,624 T189A unknown Het
Ppp1r12b T C 1: 134,876,069 S451G probably benign Het
Prox1 T G 1: 190,160,910 N446T probably damaging Het
Ralgapa2 T A 2: 146,353,279 R1195S probably damaging Het
Rere A G 4: 150,617,375 D37G probably damaging Het
Tfip11 T A 5: 112,334,930 M560K possibly damaging Het
Thop1 T C 10: 81,079,486 V260A probably damaging Het
Tle6 A G 10: 81,598,642 M41T possibly damaging Het
Trav13-4-dv7 T C 14: 53,757,792 S68P possibly damaging Het
Trim24 A G 6: 37,957,726 N826S probably damaging Het
Tuba3a T C 6: 125,278,470 E414G probably damaging Het
Vmn2r78 A G 7: 86,922,487 I502V probably benign Het
Vmn2r79 A T 7: 87,002,128 Y245F probably benign Het
Other mutations in Cbfa2t3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02095:Cbfa2t3 APN 8 122633493 missense probably damaging 1.00
IGL02578:Cbfa2t3 APN 8 122633448 missense possibly damaging 0.83
IGL02934:Cbfa2t3 APN 8 122647758 missense probably benign 0.03
IGL03089:Cbfa2t3 APN 8 122635134 missense probably damaging 1.00
R0196:Cbfa2t3 UTSW 8 122633337 missense possibly damaging 0.77
R0365:Cbfa2t3 UTSW 8 122635060 missense probably benign 0.23
R0395:Cbfa2t3 UTSW 8 122638951 missense probably benign 0.09
R0784:Cbfa2t3 UTSW 8 122650487 splice site probably benign
R0835:Cbfa2t3 UTSW 8 122647778 missense probably benign 0.00
R1608:Cbfa2t3 UTSW 8 122647709 missense probably damaging 0.99
R2008:Cbfa2t3 UTSW 8 122643293 missense probably damaging 0.99
R2088:Cbfa2t3 UTSW 8 122637986 unclassified probably benign
R2095:Cbfa2t3 UTSW 8 122634988 missense probably benign
R4079:Cbfa2t3 UTSW 8 122647695 splice site probably null
R4175:Cbfa2t3 UTSW 8 122643318 missense probably damaging 1.00
R5013:Cbfa2t3 UTSW 8 122638859 missense possibly damaging 0.95
R5141:Cbfa2t3 UTSW 8 122635021 missense probably benign 0.24
R5391:Cbfa2t3 UTSW 8 122633395 nonsense probably null
R6067:Cbfa2t3 UTSW 8 122643497 missense probably benign 0.00
R6078:Cbfa2t3 UTSW 8 122643497 missense probably benign 0.00
R6192:Cbfa2t3 UTSW 8 122634396 missense probably benign 0.00
R6281:Cbfa2t3 UTSW 8 122633409 missense probably damaging 1.00
R6520:Cbfa2t3 UTSW 8 122635801 missense probably benign 0.02
R6936:Cbfa2t3 UTSW 8 122647739 missense probably damaging 0.97
R7154:Cbfa2t3 UTSW 8 122638144 nonsense probably null
R7196:Cbfa2t3 UTSW 8 122638990 missense probably benign 0.26
R7295:Cbfa2t3 UTSW 8 122638029 missense probably benign 0.02
R7514:Cbfa2t3 UTSW 8 122635126 missense probably damaging 1.00
R7616:Cbfa2t3 UTSW 8 122633337 missense possibly damaging 0.87
U15987:Cbfa2t3 UTSW 8 122643497 missense probably benign 0.00
Z1176:Cbfa2t3 UTSW 8 122698895 start gained probably benign
Z1177:Cbfa2t3 UTSW 8 122630757 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCACAGCATCTTCTGTC -3'
(R):5'- TTCTGCCGCAAGCTCCATTG -3'

Sequencing Primer
(F):5'- ACAGCATCTTCTGTCACCCTG -3'
(R):5'- GCAAGCTCCATTGCGATG -3'
Posted On2020-01-23