Incidental Mutation 'R8070:Olfr1384'
ID620248
Institutional Source Beutler Lab
Gene Symbol Olfr1384
Ensembl Gene ENSMUSG00000044170
Gene Nameolfactory receptor 1384
SynonymsGA_x6K02T2QP88-5922712-5921756, MOR256-23
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R8070 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location49506724-49517345 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49514114 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 159 (T159S)
Ref Sequence ENSEMBL: ENSMUSP00000149183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060434] [ENSMUST00000213776]
Predicted Effect probably damaging
Transcript: ENSMUST00000060434
AA Change: T159S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051954
Gene: ENSMUSG00000044170
AA Change: T159S

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 6.9e-48 PFAM
Pfam:7TM_GPCR_Srsx 34 161 4.3e-6 PFAM
Pfam:7tm_1 40 313 2.7e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213776
AA Change: T159S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik A G 5: 63,898,167 E82G probably benign Het
9830107B12Rik A G 17: 48,145,510 F86S probably damaging Het
Aamdc A T 7: 97,575,648 Y2* probably null Het
Acta1 T A 8: 123,893,621 D26V possibly damaging Het
Adra1d A C 2: 131,561,582 L196R probably damaging Het
Agbl2 G A 2: 90,791,565 C132Y probably benign Het
Amd1 A G 10: 40,294,230 V92A probably benign Het
Arid4b T A 13: 14,136,259 I149K probably benign Het
Atg7 A G 6: 114,697,080 M312V probably benign Het
Bap1 T A 14: 31,256,686 V381E probably damaging Het
Cbfa2t3 C T 8: 122,642,981 V207I possibly damaging Het
Cdh24 T C 14: 54,632,573 Q629R probably benign Het
Cdhr2 G T 13: 54,719,793 V479L probably benign Het
Chd2 A G 7: 73,451,758 S1407P probably benign Het
Clstn2 A G 9: 97,799,470 V39A possibly damaging Het
Cwh43 T A 5: 73,421,463 M357K possibly damaging Het
Dcdc2a T A 13: 25,202,197 D351E probably benign Het
Dennd6b T C 15: 89,185,373 I517V probably benign Het
Dnah17 T C 11: 118,024,671 E4374G probably damaging Het
Emsy A G 7: 98,626,715 S336P possibly damaging Het
Enoph1 A T 5: 100,060,982 E65D probably benign Het
Fam83f T A 15: 80,672,080 L55Q probably damaging Het
Fry T C 5: 150,478,007 F379L Het
Fscb A T 12: 64,474,608 M28K probably benign Het
Gas7 G A 11: 67,683,434 V412M probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gcn1l1 T A 5: 115,588,998 V638E probably benign Het
Ggt1 A T 10: 75,578,899 I184F probably damaging Het
Gigyf2 A G 1: 87,440,907 N1103S probably benign Het
Gm13757 G T 2: 88,446,659 T93K probably benign Het
Gm5592 G A 7: 41,286,463 A130T possibly damaging Het
Gys2 T C 6: 142,448,504 probably null Het
Hmcn1 C A 1: 150,649,992 E3327* probably null Het
Ighv1-36 C T 12: 114,880,036 G68E probably damaging Het
Igkv6-32 G A 6: 70,074,105 T89M probably damaging Het
Ipo7 A G 7: 110,052,807 D931G probably benign Het
Jakmip1 A G 5: 37,173,287 E437G probably benign Het
Lingo3 C T 10: 80,836,121 probably benign Het
Lnpep A G 17: 17,538,638 S815P probably damaging Het
Ly6a T C 15: 74,997,600 D2G probably damaging Het
Madd C A 2: 91,158,014 E1223* probably null Het
Mapk8ip3 A T 17: 24,901,104 probably null Het
Mecom T C 3: 29,979,838 E239G probably damaging Het
Mug1 T C 6: 121,875,879 V889A probably benign Het
Myo18b T A 5: 112,791,120 N1675I probably benign Het
Ndrg4 T C 8: 95,700,128 F50L possibly damaging Het
Ndst4 A G 3: 125,714,644 Y286C probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfm3 A G 3: 115,101,955 D195G probably damaging Het
Pds5a A G 5: 65,652,398 L407P possibly damaging Het
Pgm1 A G 5: 64,112,082 N504S probably benign Het
Plce1 A G 19: 38,701,839 M656V probably damaging Het
Pou6f2 T C 13: 18,239,624 T189A unknown Het
Ppp1r12b T C 1: 134,876,069 S451G probably benign Het
Prox1 T G 1: 190,160,910 N446T probably damaging Het
Ralgapa2 T A 2: 146,353,279 R1195S probably damaging Het
Rere A G 4: 150,617,375 D37G probably damaging Het
Tfip11 T A 5: 112,334,930 M560K possibly damaging Het
Thop1 T C 10: 81,079,486 V260A probably damaging Het
Tle6 A G 10: 81,598,642 M41T possibly damaging Het
Trav13-4-dv7 T C 14: 53,757,792 S68P possibly damaging Het
Trim24 A G 6: 37,957,726 N826S probably damaging Het
Tuba3a T C 6: 125,278,470 E414G probably damaging Het
Vmn2r78 A G 7: 86,922,487 I502V probably benign Het
Vmn2r79 A T 7: 87,002,128 Y245F probably benign Het
Other mutations in Olfr1384
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02212:Olfr1384 APN 11 49513910 missense probably damaging 0.98
IGL02972:Olfr1384 APN 11 49514091 missense probably damaging 1.00
R0157:Olfr1384 UTSW 11 49513773 missense probably damaging 1.00
R1106:Olfr1384 UTSW 11 49513692 missense probably damaging 1.00
R1213:Olfr1384 UTSW 11 49514594 makesense probably null
R3768:Olfr1384 UTSW 11 49513773 missense probably damaging 1.00
R4191:Olfr1384 UTSW 11 49513812 missense probably damaging 1.00
R4708:Olfr1384 UTSW 11 49514389 nonsense probably null
R5443:Olfr1384 UTSW 11 49514435 missense probably damaging 0.98
R5770:Olfr1384 UTSW 11 49514592 missense unknown
R6245:Olfr1384 UTSW 11 49514165 missense possibly damaging 0.94
R6336:Olfr1384 UTSW 11 49514542 missense probably damaging 0.99
R7652:Olfr1384 UTSW 11 49513685 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTCTTTCCCGAGGTGATCAG -3'
(R):5'- GGTGCCTAGAATTAGTGCTACAGG -3'

Sequencing Primer
(F):5'- TTCCCGAGGTGATCAGACTATCAG -3'
(R):5'- CCTAGAATTAGTGCTACAGGACAGAC -3'
Posted On2020-01-23