Incidental Mutation 'R8070:Gas7'
ID620249
Institutional Source Beutler Lab
Gene Symbol Gas7
Ensembl Gene ENSMUSG00000033066
Gene Namegrowth arrest specific 7
SynonymsB230343A10Rik, Gas7-cb
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8070 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location67455437-67688990 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67683434 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 412 (V412M)
Ref Sequence ENSEMBL: ENSMUSP00000104322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021289] [ENSMUST00000041611] [ENSMUST00000108680] [ENSMUST00000108681] [ENSMUST00000108682]
Predicted Effect probably benign
Transcript: ENSMUST00000021289
SMART Domains Protein: ENSMUSP00000021289
Gene: ENSMUSG00000049928

DomainStartEndE-ValueType
Pfam:7tm_2 17 225 4.8e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000041611
AA Change: V408M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038420
Gene: ENSMUSG00000033066
AA Change: V408M

DomainStartEndE-ValueType
WW 14 46 1.39e-11 SMART
FCH 146 232 6.62e-25 SMART
coiled coil region 260 304 N/A INTRINSIC
low complexity region 335 354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108680
AA Change: V408M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104320
Gene: ENSMUSG00000033066
AA Change: V408M

DomainStartEndE-ValueType
WW 14 46 1.39e-11 SMART
FCH 146 232 6.62e-25 SMART
coiled coil region 260 304 N/A INTRINSIC
low complexity region 335 354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108681
AA Change: V408M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104321
Gene: ENSMUSG00000033066
AA Change: V408M

DomainStartEndE-ValueType
WW 14 46 1.39e-11 SMART
FCH 146 232 6.62e-25 SMART
coiled coil region 260 304 N/A INTRINSIC
low complexity region 335 354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108682
AA Change: V412M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104322
Gene: ENSMUSG00000033066
AA Change: V412M

DomainStartEndE-ValueType
WW 18 50 1.39e-11 SMART
FCH 150 236 6.62e-25 SMART
coiled coil region 264 308 N/A INTRINSIC
low complexity region 339 358 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Growth arrest-specific 7 is expressed primarily in terminally differentiated brain cells and predominantly in mature cerebellar Purkinje neurons. GAS7 plays a putative role in neuronal development. Several transcript variants encoding proteins which vary in the N-terminus have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Aged mice homozygous for a hypomorphic allele show impaired coordination, decreased grip strength, decreased motor neuron number, muscle weakness, abnormal skeletal muscle fiber type ratio in the soleus muscle, and defects in motor neuron axon terminal sprouting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik A G 5: 63,898,167 E82G probably benign Het
9830107B12Rik A G 17: 48,145,510 F86S probably damaging Het
Aamdc A T 7: 97,575,648 Y2* probably null Het
Acta1 T A 8: 123,893,621 D26V possibly damaging Het
Adra1d A C 2: 131,561,582 L196R probably damaging Het
Agbl2 G A 2: 90,791,565 C132Y probably benign Het
Amd1 A G 10: 40,294,230 V92A probably benign Het
Arid4b T A 13: 14,136,259 I149K probably benign Het
Atg7 A G 6: 114,697,080 M312V probably benign Het
Bap1 T A 14: 31,256,686 V381E probably damaging Het
Cbfa2t3 C T 8: 122,642,981 V207I possibly damaging Het
Cdh24 T C 14: 54,632,573 Q629R probably benign Het
Cdhr2 G T 13: 54,719,793 V479L probably benign Het
Chd2 A G 7: 73,451,758 S1407P probably benign Het
Clstn2 A G 9: 97,799,470 V39A possibly damaging Het
Cwh43 T A 5: 73,421,463 M357K possibly damaging Het
Dcdc2a T A 13: 25,202,197 D351E probably benign Het
Dennd6b T C 15: 89,185,373 I517V probably benign Het
Dnah17 T C 11: 118,024,671 E4374G probably damaging Het
Emsy A G 7: 98,626,715 S336P possibly damaging Het
Enoph1 A T 5: 100,060,982 E65D probably benign Het
Fam83f T A 15: 80,672,080 L55Q probably damaging Het
Fry T C 5: 150,478,007 F379L Het
Fscb A T 12: 64,474,608 M28K probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gcn1l1 T A 5: 115,588,998 V638E probably benign Het
Ggt1 A T 10: 75,578,899 I184F probably damaging Het
Gigyf2 A G 1: 87,440,907 N1103S probably benign Het
Gm13757 G T 2: 88,446,659 T93K probably benign Het
Gm5592 G A 7: 41,286,463 A130T possibly damaging Het
Gys2 T C 6: 142,448,504 probably null Het
Hmcn1 C A 1: 150,649,992 E3327* probably null Het
Ighv1-36 C T 12: 114,880,036 G68E probably damaging Het
Igkv6-32 G A 6: 70,074,105 T89M probably damaging Het
Ipo7 A G 7: 110,052,807 D931G probably benign Het
Jakmip1 A G 5: 37,173,287 E437G probably benign Het
Lingo3 C T 10: 80,836,121 probably benign Het
Lnpep A G 17: 17,538,638 S815P probably damaging Het
Ly6a T C 15: 74,997,600 D2G probably damaging Het
Madd C A 2: 91,158,014 E1223* probably null Het
Mapk8ip3 A T 17: 24,901,104 probably null Het
Mecom T C 3: 29,979,838 E239G probably damaging Het
Mug1 T C 6: 121,875,879 V889A probably benign Het
Myo18b T A 5: 112,791,120 N1675I probably benign Het
Ndrg4 T C 8: 95,700,128 F50L possibly damaging Het
Ndst4 A G 3: 125,714,644 Y286C probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfm3 A G 3: 115,101,955 D195G probably damaging Het
Olfr1384 A T 11: 49,514,114 T159S probably damaging Het
Pds5a A G 5: 65,652,398 L407P possibly damaging Het
Pgm1 A G 5: 64,112,082 N504S probably benign Het
Plce1 A G 19: 38,701,839 M656V probably damaging Het
Pou6f2 T C 13: 18,239,624 T189A unknown Het
Ppp1r12b T C 1: 134,876,069 S451G probably benign Het
Prox1 T G 1: 190,160,910 N446T probably damaging Het
Ralgapa2 T A 2: 146,353,279 R1195S probably damaging Het
Rere A G 4: 150,617,375 D37G probably damaging Het
Tfip11 T A 5: 112,334,930 M560K possibly damaging Het
Thop1 T C 10: 81,079,486 V260A probably damaging Het
Tle6 A G 10: 81,598,642 M41T possibly damaging Het
Trav13-4-dv7 T C 14: 53,757,792 S68P possibly damaging Het
Trim24 A G 6: 37,957,726 N826S probably damaging Het
Tuba3a T C 6: 125,278,470 E414G probably damaging Het
Vmn2r78 A G 7: 86,922,487 I502V probably benign Het
Vmn2r79 A T 7: 87,002,128 Y245F probably benign Het
Other mutations in Gas7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Gas7 APN 11 67652914 critical splice donor site probably null
IGL01634:Gas7 APN 11 67674231 splice site probably benign
IGL02215:Gas7 APN 11 67643332 missense probably benign 0.33
IGL02338:Gas7 APN 11 67682731 missense probably damaging 0.99
IGL02547:Gas7 APN 11 67665435 missense probably damaging 0.99
IGL02679:Gas7 APN 11 67675727 splice site probably null
IGL02959:Gas7 APN 11 67674235 splice site probably benign
R0029:Gas7 UTSW 11 67643337 missense probably benign 0.05
R0335:Gas7 UTSW 11 67662052 missense possibly damaging 0.84
R0931:Gas7 UTSW 11 67652925 splice site probably benign
R1165:Gas7 UTSW 11 67670686 splice site probably benign
R1459:Gas7 UTSW 11 67662076 missense probably damaging 1.00
R2425:Gas7 UTSW 11 67643295 missense probably benign 0.00
R4953:Gas7 UTSW 11 67660050 missense possibly damaging 0.69
R4969:Gas7 UTSW 11 67683408 missense probably damaging 0.98
R5327:Gas7 UTSW 11 67662090 missense probably damaging 1.00
R6145:Gas7 UTSW 11 67629612 missense probably damaging 1.00
R6631:Gas7 UTSW 11 67674281 missense probably damaging 1.00
R6885:Gas7 UTSW 11 67683387 missense probably damaging 0.99
R6914:Gas7 UTSW 11 67660151 intron probably null
R6942:Gas7 UTSW 11 67660151 intron probably null
Predicted Primers PCR Primer
(F):5'- CTTCTAGAAAGGGTGATCTGAGGTG -3'
(R):5'- ATGGCCTGGAAATACTGGGG -3'

Sequencing Primer
(F):5'- TGGCTCTCCAACTGCAGCAG -3'
(R):5'- CCTGGAAATACTGGGGAGTCC -3'
Posted On2020-01-23