Incidental Mutation 'R0666:Topbp1'
ID62025
Institutional Source Beutler Lab
Gene Symbol Topbp1
Ensembl Gene ENSMUSG00000032555
Gene Nametopoisomerase (DNA) II binding protein 1
SynonymsD430026L04Rik, 2810429C13Rik, 1110031N14Rik
MMRRC Submission 038851-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0666 (G1)
Quality Score109
Status Validated
Chromosome9
Chromosomal Location103305215-103350428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 103308812 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 51 (R51K)
Ref Sequence ENSEMBL: ENSMUSP00000139773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035164] [ENSMUST00000142540] [ENSMUST00000187065]
Predicted Effect probably benign
Transcript: ENSMUST00000035164
AA Change: R51K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035164
Gene: ENSMUSG00000032555
AA Change: R51K

DomainStartEndE-ValueType
BRCT 6 91 3.04e1 SMART
BRCT 103 179 1.51e-13 SMART
BRCT 197 274 4.69e-19 SMART
BRCT 355 433 3.58e-15 SMART
BRCT 553 626 5.57e-3 SMART
BRCT 646 731 1.53e-9 SMART
BRCT 904 983 3.48e-13 SMART
low complexity region 1097 1106 N/A INTRINSIC
low complexity region 1110 1121 N/A INTRINSIC
low complexity region 1213 1218 N/A INTRINSIC
BRCT 1258 1337 2.31e-9 SMART
Blast:BRCT 1387 1472 4e-52 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000142540
Predicted Effect probably benign
Transcript: ENSMUST00000187065
AA Change: R51K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139773
Gene: ENSMUSG00000032555
AA Change: R51K

DomainStartEndE-ValueType
PDB:2XNH|A 1 130 2e-81 PDB
Blast:BRCT 6 91 8e-58 BLAST
Blast:BRCT 103 130 2e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189631
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a binding protein which interacts with the C-terminal region of topoisomerase II beta. This interaction suggests a supportive role for this protein in the catalytic reactions of topoisomerase II beta through transient breakages of DNA strands. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die around implantation due to embryonic growth arrest, increased apoptosis, and decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T G 11: 78,287,987 M2026R probably damaging Het
2610507B11Rik T A 11: 78,277,212 L1491* probably null Het
Akap6 T A 12: 52,911,808 V782E probably damaging Het
Atg9a A G 1: 75,185,090 L604P probably damaging Het
Atp1a3 T C 7: 24,990,549 I482V probably benign Het
Ccdc105 C A 10: 78,750,547 L223F probably benign Het
Ccdc18 T G 5: 108,163,664 V412G probably benign Het
Cct6a A G 5: 129,794,386 noncoding transcript Het
Clpx A G 9: 65,310,225 N25S probably damaging Het
Cnpy2 T A 10: 128,327,025 C171* probably null Het
Cntnap3 C T 13: 64,757,397 D857N probably damaging Het
Col5a1 A G 2: 28,032,685 Y255C probably damaging Het
Coro7 A T 16: 4,631,911 F638Y possibly damaging Het
Cpd A G 11: 76,782,327 F1331L probably damaging Het
Csmd1 A T 8: 16,069,049 I1842N possibly damaging Het
Dgkg T A 16: 22,562,730 D490V probably damaging Het
Dnah9 A T 11: 66,085,458 M1255K probably benign Het
E2f1 A G 2: 154,560,929 V306A probably benign Het
Entpd1 A G 19: 40,659,906 probably benign Het
Esrrb T A 12: 86,505,902 I222N probably benign Het
Fam159b G T 13: 104,858,354 T95K possibly damaging Het
Flt4 G T 11: 49,625,447 A126S possibly damaging Het
Galnt11 C T 5: 25,252,147 T237I possibly damaging Het
Gbf1 A G 19: 46,262,544 probably benign Het
Gm20388 A T 8: 122,270,988 probably benign Het
Gm7030 T C 17: 36,127,834 T222A possibly damaging Het
Herc1 T A 9: 66,484,888 probably benign Het
Hsph1 T C 5: 149,631,502 Y105C probably damaging Het
Il23r T C 6: 67,434,680 T358A probably benign Het
Il2ra C T 2: 11,643,073 probably benign Het
Kbtbd4 G T 2: 90,914,115 probably benign Het
Kcnt1 A G 2: 25,891,243 probably benign Het
Kng2 A G 16: 22,997,122 probably benign Het
Lap3 C T 5: 45,511,928 T473I possibly damaging Het
Lrrk2 T C 15: 91,757,070 probably null Het
Map1s A G 8: 70,914,052 N534D possibly damaging Het
Mtg1 G A 7: 140,144,344 V122I probably benign Het
Myadm T A 7: 3,297,349 I209K probably damaging Het
Ntsr2 G A 12: 16,653,980 V75I probably benign Het
Olfr1037 G A 2: 86,085,213 A188V probably benign Het
Olfr1272 A T 2: 90,281,868 S236T probably damaging Het
Pfn1 T C 11: 70,654,366 T39A probably benign Het
Pipox T A 11: 77,883,825 K144M probably benign Het
Plekhh1 G A 12: 79,069,115 E811K probably damaging Het
Pnpla3 T A 15: 84,179,305 W295R probably benign Het
Prkacb T A 3: 146,751,518 T136S probably damaging Het
Ralbp1 T A 17: 65,854,129 N473I probably benign Het
Rbp4 G A 19: 38,118,460 T127M probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rps3a1 G A 3: 86,138,117 probably benign Het
Scg3 G T 9: 75,643,940 Y429* probably null Het
Spag5 T C 11: 78,313,396 S492P probably damaging Het
St7 T A 6: 17,934,239 M540K probably damaging Het
Stxbp3 C A 3: 108,805,302 V281F possibly damaging Het
Sun5 A G 2: 153,859,048 V242A possibly damaging Het
Susd5 G T 9: 114,095,784 R245L possibly damaging Het
Syne2 A G 12: 75,923,013 E954G probably damaging Het
Synpo2 A T 3: 123,114,059 V536E probably damaging Het
Tas2r140 T C 6: 133,055,442 I118V probably benign Het
Tbx18 C A 9: 87,724,409 V228L probably benign Het
Tdrd9 T A 12: 112,007,580 probably benign Het
Tg T C 15: 66,737,521 M310T probably benign Het
Ticam2 T A 18: 46,560,651 D123V probably damaging Het
Timm23 A G 14: 32,199,036 probably benign Het
Tinag C T 9: 77,005,687 R280H probably benign Het
Tor1b A G 2: 30,953,913 I121V probably damaging Het
Tpmt C A 13: 47,032,454 G148V probably damaging Het
Tubb1 A G 2: 174,457,755 E410G probably damaging Het
Ubash3b C A 9: 41,047,064 V7L possibly damaging Het
Ube2o C T 11: 116,542,835 E686K probably damaging Het
Unc13d T A 11: 116,069,492 probably benign Het
Vmn1r183 A T 7: 24,055,176 M135L probably benign Het
Wisp3 T C 10: 39,151,289 R316G probably benign Het
Xkr8 T C 4: 132,732,338 Y43C probably damaging Het
Zc3h4 T A 7: 16,434,772 N935K unknown Het
Zc3h7a G A 16: 11,156,303 probably benign Het
Zfp84 C T 7: 29,776,851 H323Y probably damaging Het
Zfp873 G T 10: 82,060,761 S442I possibly damaging Het
Zfp938 A G 10: 82,225,772 L338P probably damaging Het
Other mutations in Topbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Topbp1 APN 9 103344943 missense probably benign
IGL01524:Topbp1 APN 9 103311645 missense possibly damaging 0.92
IGL02335:Topbp1 APN 9 103328523 missense probably damaging 1.00
IGL02441:Topbp1 APN 9 103320239 missense possibly damaging 0.49
IGL02943:Topbp1 APN 9 103328440 missense probably benign 0.00
IGL02953:Topbp1 APN 9 103328435 missense probably benign 0.26
IGL03040:Topbp1 APN 9 103328667 missense possibly damaging 0.51
PIT4377001:Topbp1 UTSW 9 103309889 missense possibly damaging 0.90
R0044:Topbp1 UTSW 9 103325773 missense possibly damaging 0.94
R0344:Topbp1 UTSW 9 103328687 missense probably damaging 0.99
R0344:Topbp1 UTSW 9 103308733 splice site probably benign
R0591:Topbp1 UTSW 9 103349838 missense probably benign 0.01
R0785:Topbp1 UTSW 9 103315090 missense probably damaging 1.00
R0906:Topbp1 UTSW 9 103328593 missense probably benign 0.00
R1352:Topbp1 UTSW 9 103347008 missense probably benign
R1745:Topbp1 UTSW 9 103308845 missense probably benign 0.36
R2104:Topbp1 UTSW 9 103317982 splice site probably benign
R2166:Topbp1 UTSW 9 103312929 splice site probably null
R2230:Topbp1 UTSW 9 103345848 missense probably damaging 1.00
R2967:Topbp1 UTSW 9 103342140 missense probably benign 0.01
R3845:Topbp1 UTSW 9 103309923 missense possibly damaging 0.87
R4089:Topbp1 UTSW 9 103324501 critical splice donor site probably null
R4110:Topbp1 UTSW 9 103309959 missense probably damaging 0.98
R4454:Topbp1 UTSW 9 103344871 missense probably damaging 1.00
R4521:Topbp1 UTSW 9 103334202 intron probably benign
R4745:Topbp1 UTSW 9 103323571 missense probably damaging 1.00
R4923:Topbp1 UTSW 9 103312836 missense probably benign 0.00
R4934:Topbp1 UTSW 9 103328369 unclassified probably benign
R4963:Topbp1 UTSW 9 103320605 missense probably benign 0.04
R5199:Topbp1 UTSW 9 103346672 unclassified probably benign
R5461:Topbp1 UTSW 9 103315196 missense probably benign 0.00
R5517:Topbp1 UTSW 9 103336114 missense probably benign 0.03
R5563:Topbp1 UTSW 9 103311513 missense possibly damaging 0.46
R5564:Topbp1 UTSW 9 103334078 missense probably damaging 1.00
R5683:Topbp1 UTSW 9 103312804 missense possibly damaging 0.93
R5774:Topbp1 UTSW 9 103328499 missense probably benign 0.06
R5785:Topbp1 UTSW 9 103323528 missense probably benign 0.00
R6029:Topbp1 UTSW 9 103344953 missense probably benign 0.00
R6077:Topbp1 UTSW 9 103332990 missense probably damaging 1.00
R6122:Topbp1 UTSW 9 103346961 missense probably benign 0.06
R6133:Topbp1 UTSW 9 103311764 splice site probably null
R6213:Topbp1 UTSW 9 103332751 missense probably benign 0.12
R6773:Topbp1 UTSW 9 103343692 missense possibly damaging 0.90
R6922:Topbp1 UTSW 9 103335846 missense probably damaging 1.00
R6938:Topbp1 UTSW 9 103328554 missense probably damaging 1.00
R7305:Topbp1 UTSW 9 103328637 missense probably damaging 1.00
R7419:Topbp1 UTSW 9 103323344 missense probably benign
R7517:Topbp1 UTSW 9 103332733 missense possibly damaging 0.82
R7605:Topbp1 UTSW 9 103332706 missense probably benign 0.41
R7701:Topbp1 UTSW 9 103332985 missense probably damaging 0.96
R7741:Topbp1 UTSW 9 103320557 missense probably damaging 0.97
R8115:Topbp1 UTSW 9 103320541 missense probably benign
R8177:Topbp1 UTSW 9 103320541 missense probably benign 0.01
R8269:Topbp1 UTSW 9 103328593 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GCTGGGTTTGAAATTAGCTCTGAGCAC -3'
(R):5'- GCCCAAAGAATCCCAAGGTACTCGTAG -3'

Sequencing Primer
(F):5'- TAGCTCTGAGCACTTAGTAGGAC -3'
(R):5'- GAATGAGACCCTacacacgc -3'
Posted On2013-07-30