Incidental Mutation 'R8070:Bap1'
ID620257
Institutional Source Beutler Lab
Gene Symbol Bap1
Ensembl Gene ENSMUSG00000021901
Gene NameBrca1 associated protein 1
Synonyms2300006C11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8070 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location31251450-31259944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31256686 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 381 (V381E)
Ref Sequence ENSEMBL: ENSMUSP00000022458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022458] [ENSMUST00000048603] [ENSMUST00000187156] [ENSMUST00000188453]
Predicted Effect probably damaging
Transcript: ENSMUST00000022458
AA Change: V381E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022458
Gene: ENSMUSG00000021901
AA Change: V381E

DomainStartEndE-ValueType
Pfam:Peptidase_C12 5 215 3e-70 PFAM
low complexity region 282 293 N/A INTRINSIC
low complexity region 396 407 N/A INTRINSIC
low complexity region 577 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048603
SMART Domains Protein: ENSMUSP00000043281
Gene: ENSMUSG00000019027

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DHC_N2 998 1404 6.3e-146 PFAM
AAA 1558 1697 6.02e-1 SMART
AAA 1839 2077 4.66e0 SMART
low complexity region 2149 2157 N/A INTRINSIC
AAA 2204 2353 2.35e-1 SMART
Pfam:AAA_8 2533 2803 7.7e-84 PFAM
Pfam:MT 2815 3165 9.9e-57 PFAM
Pfam:AAA_9 3185 3410 1.1e-93 PFAM
Pfam:Dynein_heavy 3545 4246 2.7e-275 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000187156
AA Change: V18E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139903
Gene: ENSMUSG00000021901
AA Change: V18E

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188453
SMART Domains Protein: ENSMUSP00000139824
Gene: ENSMUSG00000021901

DomainStartEndE-ValueType
Pfam:Peptidase_C12 4 137 3.7e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ubiquitin C-terminal hydrolase subfamily of deubiquitinating enzymes that are involved in the removal of ubiquitin from proteins. The encoded enzyme binds to the breast cancer type 1 susceptibility protein (BRCA1) via the RING finger domain of the latter and acts as a tumor suppressor. In addition, the enzyme may be involved in regulation of transcription, regulation of cell cycle and growth, response to DNA damage and chromatin dynamics. Germline mutations in this gene may be associated with tumor predisposition syndrome (TPDS), which involves increased risk of cancers including malignant mesothelioma, uveal melanoma and cutaneous melanoma. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous deletion of this gene causes delayed embryonic growth and complete lethality during organogenesis. Systemic or hematopoietic-restricted deletion in adults recapitulates features of myelodysplastic syndrome. Heterozygotes show increased incidence of asbestos-induced malignant mesothelioma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik A G 5: 63,898,167 E82G probably benign Het
9830107B12Rik A G 17: 48,145,510 F86S probably damaging Het
Aamdc A T 7: 97,575,648 Y2* probably null Het
Acta1 T A 8: 123,893,621 D26V possibly damaging Het
Adra1d A C 2: 131,561,582 L196R probably damaging Het
Agbl2 G A 2: 90,791,565 C132Y probably benign Het
Amd1 A G 10: 40,294,230 V92A probably benign Het
Arid4b T A 13: 14,136,259 I149K probably benign Het
Atg7 A G 6: 114,697,080 M312V probably benign Het
Cbfa2t3 C T 8: 122,642,981 V207I possibly damaging Het
Cdh24 T C 14: 54,632,573 Q629R probably benign Het
Cdhr2 G T 13: 54,719,793 V479L probably benign Het
Chd2 A G 7: 73,451,758 S1407P probably benign Het
Clstn2 A G 9: 97,799,470 V39A possibly damaging Het
Cwh43 T A 5: 73,421,463 M357K possibly damaging Het
Dcdc2a T A 13: 25,202,197 D351E probably benign Het
Dennd6b T C 15: 89,185,373 I517V probably benign Het
Dnah17 T C 11: 118,024,671 E4374G probably damaging Het
Emsy A G 7: 98,626,715 S336P possibly damaging Het
Enoph1 A T 5: 100,060,982 E65D probably benign Het
Fam83f T A 15: 80,672,080 L55Q probably damaging Het
Fry T C 5: 150,478,007 F379L Het
Fscb A T 12: 64,474,608 M28K probably benign Het
Gas7 G A 11: 67,683,434 V412M probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gcn1l1 T A 5: 115,588,998 V638E probably benign Het
Ggt1 A T 10: 75,578,899 I184F probably damaging Het
Gigyf2 A G 1: 87,440,907 N1103S probably benign Het
Gm13757 G T 2: 88,446,659 T93K probably benign Het
Gm5592 G A 7: 41,286,463 A130T possibly damaging Het
Gys2 T C 6: 142,448,504 probably null Het
Hmcn1 C A 1: 150,649,992 E3327* probably null Het
Ighv1-36 C T 12: 114,880,036 G68E probably damaging Het
Igkv6-32 G A 6: 70,074,105 T89M probably damaging Het
Ipo7 A G 7: 110,052,807 D931G probably benign Het
Jakmip1 A G 5: 37,173,287 E437G probably benign Het
Lingo3 C T 10: 80,836,121 probably benign Het
Lnpep A G 17: 17,538,638 S815P probably damaging Het
Ly6a T C 15: 74,997,600 D2G probably damaging Het
Madd C A 2: 91,158,014 E1223* probably null Het
Mapk8ip3 A T 17: 24,901,104 probably null Het
Mecom T C 3: 29,979,838 E239G probably damaging Het
Mug1 T C 6: 121,875,879 V889A probably benign Het
Myo18b T A 5: 112,791,120 N1675I probably benign Het
Ndrg4 T C 8: 95,700,128 F50L possibly damaging Het
Ndst4 A G 3: 125,714,644 Y286C probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfm3 A G 3: 115,101,955 D195G probably damaging Het
Olfr1384 A T 11: 49,514,114 T159S probably damaging Het
Pds5a A G 5: 65,652,398 L407P possibly damaging Het
Pgm1 A G 5: 64,112,082 N504S probably benign Het
Plce1 A G 19: 38,701,839 M656V probably damaging Het
Pou6f2 T C 13: 18,239,624 T189A unknown Het
Ppp1r12b T C 1: 134,876,069 S451G probably benign Het
Prox1 T G 1: 190,160,910 N446T probably damaging Het
Ralgapa2 T A 2: 146,353,279 R1195S probably damaging Het
Rere A G 4: 150,617,375 D37G probably damaging Het
Tfip11 T A 5: 112,334,930 M560K possibly damaging Het
Thop1 T C 10: 81,079,486 V260A probably damaging Het
Tle6 A G 10: 81,598,642 M41T possibly damaging Het
Trav13-4-dv7 T C 14: 53,757,792 S68P possibly damaging Het
Trim24 A G 6: 37,957,726 N826S probably damaging Het
Tuba3a T C 6: 125,278,470 E414G probably damaging Het
Vmn2r78 A G 7: 86,922,487 I502V probably benign Het
Vmn2r79 A T 7: 87,002,128 Y245F probably benign Het
Other mutations in Bap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Bap1 APN 14 31253569 missense probably damaging 0.97
IGL02110:Bap1 APN 14 31257414 missense probably damaging 0.97
IGL02740:Bap1 APN 14 31256772 missense possibly damaging 0.94
IGL02937:Bap1 APN 14 31258327 missense probably benign 0.07
R0138:Bap1 UTSW 14 31256724 missense probably damaging 1.00
R1221:Bap1 UTSW 14 31257651 missense probably damaging 1.00
R2131:Bap1 UTSW 14 31258331 nonsense probably null
R2204:Bap1 UTSW 14 31256701 missense probably benign 0.10
R3781:Bap1 UTSW 14 31257618 missense possibly damaging 0.71
R4882:Bap1 UTSW 14 31251721 unclassified probably benign
R4897:Bap1 UTSW 14 31258445 unclassified probably benign
R5249:Bap1 UTSW 14 31257286 unclassified probably benign
R6548:Bap1 UTSW 14 31256225 missense probably benign 0.01
R6990:Bap1 UTSW 14 31255651 missense probably benign
R7203:Bap1 UTSW 14 31254169 missense probably damaging 1.00
R7212:Bap1 UTSW 14 31251623 missense probably damaging 0.99
R7414:Bap1 UTSW 14 31253615 missense probably benign 0.05
R7956:Bap1 UTSW 14 31255568 missense probably benign 0.11
R8062:Bap1 UTSW 14 31257508 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- AGTTGGGTATACTCCTTGGCAC -3'
(R):5'- CTACTGTTCTCTCAGACGCAGG -3'

Sequencing Primer
(F):5'- GGCACATGGGAAAGTTTCTCC -3'
(R):5'- TCTCAGACGCAGGGTGGAATATTG -3'
Posted On2020-01-23