Incidental Mutation 'R8072:Col3a1'
ID620267
Institutional Source Beutler Lab
Gene Symbol Col3a1
Ensembl Gene ENSMUSG00000026043
Gene Namecollagen, type III, alpha 1
SynonymsCol3a-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.847) question?
Stock #R8072 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location45311538-45349706 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45321574 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 55 (V55I)
Ref Sequence ENSEMBL: ENSMUSP00000085192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087883]
Predicted Effect unknown
Transcript: ENSMUST00000087883
AA Change: V55I
SMART Domains Protein: ENSMUSP00000085192
Gene: ENSMUSG00000026043
AA Change: V55I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWC 33 89 2.73e-20 SMART
low complexity region 100 140 N/A INTRINSIC
low complexity region 163 227 N/A INTRINSIC
low complexity region 230 248 N/A INTRINSIC
internal_repeat_2 249 284 3.45e-13 PROSPERO
internal_repeat_1 250 290 1.9e-17 PROSPERO
Pfam:Collagen 293 366 7.3e-9 PFAM
low complexity region 368 419 N/A INTRINSIC
internal_repeat_4 423 476 2.52e-11 PROSPERO
internal_repeat_1 427 488 1.9e-17 PROSPERO
internal_repeat_3 427 491 7.39e-12 PROSPERO
internal_repeat_2 456 491 3.45e-13 PROSPERO
Pfam:Collagen 533 592 2.6e-11 PFAM
low complexity region 632 680 N/A INTRINSIC
low complexity region 683 776 N/A INTRINSIC
low complexity region 784 815 N/A INTRINSIC
low complexity region 818 855 N/A INTRINSIC
low complexity region 865 921 N/A INTRINSIC
low complexity region 925 950 N/A INTRINSIC
low complexity region 953 974 N/A INTRINSIC
internal_repeat_4 975 1028 2.52e-11 PROSPERO
internal_repeat_3 976 1029 7.39e-12 PROSPERO
internal_repeat_5 977 991 3.33e-5 PROSPERO
internal_repeat_5 1019 1033 3.33e-5 PROSPERO
low complexity region 1037 1058 N/A INTRINSIC
Pfam:Collagen 1076 1135 5.6e-13 PFAM
Pfam:Collagen 1136 1209 4.3e-11 PFAM
COLFI 1229 1464 5.73e-166 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of the fibril-forming type III collagen found in bone, cartilage, dentin, tendon, bone marrow stroma and other connective tissue. The encoded protein forms homotrimeric type III procollagen that undergoes proteolytic processing during fibril formation. A majority of mice lacking the encoded protein die within two days of birth but about 5% of the animals survive to adulthood. The surviving mice exhibit severe cortical malformation and experience significantly shorter lifespan. The mutant mouse named "tight skin 2" exhibiting systemic sclerosis phenotype was found to harbor a missense point mutation in this gene. A pseudogene of this gene has been defined on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Most homozygous mutants die within 48 hours after birth. Surviving mutants have reduced body size, skin lesions, enlarged intestines, and die by 6 months of age from ruptured blood vessels. Occasionally intestinal rupture also results in early death. Heterozygotes exhibit tight skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,294,574 S2146P probably benign Het
Acad9 G A 3: 36,075,255 V160I probably benign Het
Ace T C 11: 105,972,959 V411A probably damaging Het
Ankrd66 T C 17: 43,543,635 E2G possibly damaging Het
Apol6 A T 15: 77,051,103 T191S probably benign Het
Arhgef17 T A 7: 100,881,797 T352S probably benign Het
Atad2 C T 15: 58,099,978 R1081Q possibly damaging Het
Atg3 G T 16: 45,187,685 V297F probably damaging Het
Atp9b A C 18: 80,765,061 S663A Het
Col10a1 G T 10: 34,390,667 V16F unknown Het
Ctns T C 11: 73,191,746 T53A probably benign Het
Cyp2b23 A T 7: 26,666,006 I468N probably damaging Het
Dcbld2 G A 16: 58,463,097 W565* probably null Het
Esco2 A T 14: 65,832,681 N16K probably benign Het
Fggy A G 4: 95,844,157 N462D possibly damaging Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Gm4846 T C 1: 166,494,672 T109A probably benign Het
H2-M11 G T 17: 36,548,134 V189L probably benign Het
Hmcn1 T A 1: 150,656,505 T3175S possibly damaging Het
Hook2 G A 8: 84,994,491 V184M probably benign Het
Hspa4l A T 3: 40,786,746 D730V probably damaging Het
Igkv4-68 C T 6: 69,305,129 M19I probably benign Het
Igsf9b C A 9: 27,317,364 T140N possibly damaging Het
Kcnj1 G A 9: 32,397,297 R339Q probably damaging Het
Lcn8 T G 2: 25,655,172 L118W probably damaging Het
Lin28a A G 4: 134,018,142 F47L possibly damaging Het
Loxl4 T C 19: 42,607,582 E144G probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrgprb1 C A 7: 48,448,147 E6* probably null Het
Mthfsd A C 8: 121,098,816 Y339D probably damaging Het
Mup11 A T 4: 60,659,778 F153L probably damaging Het
Pcdhac2 G A 18: 37,145,664 V566M probably benign Het
Plpp7 G T 2: 32,096,109 A100S probably benign Het
Prg4 T C 1: 150,456,023 T300A possibly damaging Het
Ptprd A G 4: 76,086,036 F161L probably benign Het
Pwp2 G A 10: 78,172,096 A875V possibly damaging Het
Rhd A G 4: 134,884,149 T207A possibly damaging Het
Sh2d3c C T 2: 32,753,138 R778C probably damaging Het
Slc34a3 A C 2: 25,229,277 V527G probably benign Het
Smad2 T C 18: 76,286,951 probably null Het
Sp110 GTACT GTACTACT 1: 85,587,486 probably benign Het
Spata21 C T 4: 141,112,006 Q611* probably null Het
Taf4b A G 18: 14,821,528 T554A probably benign Het
Tial1 T C 7: 128,442,470 T107A unknown Het
Ubxn6 C A 17: 56,073,195 R42L probably benign Het
Vmn2r90 A T 17: 17,726,880 N473I probably damaging Het
Ythdc1 T A 5: 86,821,274 Y351* probably null Het
Other mutations in Col3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Col3a1 APN 1 45347135 missense probably damaging 1.00
IGL00928:Col3a1 APN 1 45340858 intron probably benign
IGL00958:Col3a1 APN 1 45327595 missense unknown
IGL01353:Col3a1 APN 1 45333638 unclassified probably benign
IGL01820:Col3a1 APN 1 45321608 missense unknown
IGL01839:Col3a1 APN 1 45311830 missense unknown
IGL02517:Col3a1 APN 1 45325803 critical splice acceptor site probably null
IGL02879:Col3a1 APN 1 45340959 intron probably benign
IGL02960:Col3a1 APN 1 45328455 missense unknown
IGL03245:Col3a1 APN 1 45331109 unclassified probably benign
IGL03308:Col3a1 APN 1 45330617 splice site probably benign
Kraken UTSW 1 45327866 splice site probably null
IGL03050:Col3a1 UTSW 1 45328925 splice site probably null
PIT4520001:Col3a1 UTSW 1 45335783 critical splice donor site probably null
R0063:Col3a1 UTSW 1 45330541 splice site probably benign
R0122:Col3a1 UTSW 1 45340897 intron probably benign
R0131:Col3a1 UTSW 1 45328868 splice site probably benign
R0762:Col3a1 UTSW 1 45321526 missense unknown
R0765:Col3a1 UTSW 1 45336651 unclassified probably benign
R0853:Col3a1 UTSW 1 45343324 intron probably benign
R0898:Col3a1 UTSW 1 45333993 unclassified probably benign
R1170:Col3a1 UTSW 1 45327601 missense unknown
R1170:Col3a1 UTSW 1 45347724 missense probably damaging 1.00
R1440:Col3a1 UTSW 1 45343312 splice site probably null
R1449:Col3a1 UTSW 1 45321611 missense unknown
R1526:Col3a1 UTSW 1 45321688 missense unknown
R1572:Col3a1 UTSW 1 45345968 missense possibly damaging 0.95
R1585:Col3a1 UTSW 1 45327866 splice site probably null
R1616:Col3a1 UTSW 1 45328488 critical splice donor site probably null
R1691:Col3a1 UTSW 1 45348616 unclassified probably benign
R1876:Col3a1 UTSW 1 45342235 splice site probably null
R1937:Col3a1 UTSW 1 45334293 unclassified probably benign
R2093:Col3a1 UTSW 1 45332990 missense probably damaging 1.00
R2110:Col3a1 UTSW 1 45330145 missense unknown
R2119:Col3a1 UTSW 1 45346121 missense probably damaging 1.00
R2256:Col3a1 UTSW 1 45321632 missense unknown
R2327:Col3a1 UTSW 1 45338611 unclassified probably benign
R2518:Col3a1 UTSW 1 45337512 unclassified probably benign
R2991:Col3a1 UTSW 1 45335779 unclassified probably benign
R3405:Col3a1 UTSW 1 45338753 unclassified probably benign
R3784:Col3a1 UTSW 1 45347135 missense probably damaging 1.00
R3847:Col3a1 UTSW 1 45321990 missense unknown
R3848:Col3a1 UTSW 1 45321990 missense unknown
R3849:Col3a1 UTSW 1 45321990 missense unknown
R4502:Col3a1 UTSW 1 45348677 unclassified probably benign
R4503:Col3a1 UTSW 1 45348677 unclassified probably benign
R4764:Col3a1 UTSW 1 45346110 missense probably damaging 1.00
R4839:Col3a1 UTSW 1 45323803 splice site probably null
R4934:Col3a1 UTSW 1 45339952 unclassified probably benign
R5033:Col3a1 UTSW 1 45346110 missense probably damaging 1.00
R5123:Col3a1 UTSW 1 45333596 unclassified probably benign
R5190:Col3a1 UTSW 1 45329084 missense unknown
R5190:Col3a1 UTSW 1 45344807 intron probably benign
R5375:Col3a1 UTSW 1 45347899 splice site probably null
R5407:Col3a1 UTSW 1 45346052 missense probably benign 0.03
R5627:Col3a1 UTSW 1 45331560 unclassified probably benign
R5642:Col3a1 UTSW 1 45331712 unclassified probably benign
R6014:Col3a1 UTSW 1 45321579 nonsense probably null
R6052:Col3a1 UTSW 1 45345013 unclassified probably benign
R6263:Col3a1 UTSW 1 45321575 missense unknown
R6453:Col3a1 UTSW 1 45339378 unclassified probably benign
R6463:Col3a1 UTSW 1 45342205 intron probably benign
R6488:Col3a1 UTSW 1 45331534 unclassified probably benign
R6525:Col3a1 UTSW 1 45347179 missense possibly damaging 0.88
R6637:Col3a1 UTSW 1 45347730 missense probably damaging 1.00
R6704:Col3a1 UTSW 1 45347732 missense probably damaging 1.00
R6744:Col3a1 UTSW 1 45338622 unclassified probably benign
R6745:Col3a1 UTSW 1 45338622 unclassified probably benign
R6747:Col3a1 UTSW 1 45338622 unclassified probably benign
R6858:Col3a1 UTSW 1 45345984 missense probably damaging 1.00
R6903:Col3a1 UTSW 1 45331988 missense probably damaging 0.96
R7189:Col3a1 UTSW 1 45333657 missense unknown
R7194:Col3a1 UTSW 1 45331700 missense unknown
R7199:Col3a1 UTSW 1 45332141 missense probably null 0.99
R7204:Col3a1 UTSW 1 45322418 missense unknown
R7304:Col3a1 UTSW 1 45347811 missense unknown
R7378:Col3a1 UTSW 1 45327647 splice site probably null
R7398:Col3a1 UTSW 1 45327813 missense unknown
R7742:Col3a1 UTSW 1 45345001 missense unknown
R8177:Col3a1 UTSW 1 45335764 missense unknown
R8183:Col3a1 UTSW 1 45334810 missense unknown
R8445:Col3a1 UTSW 1 45341180 nonsense probably null
R8490:Col3a1 UTSW 1 45345956 missense probably benign 0.01
R8546:Col3a1 UTSW 1 45340939 intron probably benign
R8720:Col3a1 UTSW 1 45347733 missense unknown
R8888:Col3a1 UTSW 1 45339979 missense unknown
Z1177:Col3a1 UTSW 1 45311800 missense unknown
Predicted Primers PCR Primer
(F):5'- AAACTGTTCATTTCCAGCTGC -3'
(R):5'- TTCTTTCAGACCTCTATGCAGTAG -3'

Sequencing Primer
(F):5'- ACTGTTCATTTCCAGCTGCATAAG -3'
(R):5'- AAGGCTGTGGGCATATTG -3'
Posted On2020-01-23