Incidental Mutation 'R8072:Sp110'
ID620268
Institutional Source Beutler Lab
Gene Symbol Sp110
Ensembl Gene ENSMUSG00000070034
Gene NameSp110 nuclear body protein
Synonyms5830484A20Rik, Ipr1, Ifi75, 5031415C07Rik, 52kDa
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.442) question?
Stock #R8072 (G1)
Quality Score131.467
Status Not validated
Chromosome1
Chromosomal Location85576899-85598817 bp(-) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) GTACT to GTACTACT at 85587486 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093508]
PDB Structure
Solution structure of the SAND domain of the putative nuclear protein homolog (5830484A20Rik) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000093508
SMART Domains Protein: ENSMUSP00000091226
Gene: ENSMUSG00000070034

DomainStartEndE-ValueType
Pfam:Sp100 8 106 2.3e-41 PFAM
low complexity region 242 254 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
SAND 360 433 3.55e-28 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,294,574 S2146P probably benign Het
Acad9 G A 3: 36,075,255 V160I probably benign Het
Ace T C 11: 105,972,959 V411A probably damaging Het
Ankrd66 T C 17: 43,543,635 E2G possibly damaging Het
Apol6 A T 15: 77,051,103 T191S probably benign Het
Arhgef17 T A 7: 100,881,797 T352S probably benign Het
Atad2 C T 15: 58,099,978 R1081Q possibly damaging Het
Atg3 G T 16: 45,187,685 V297F probably damaging Het
Atp9b A C 18: 80,765,061 S663A Het
Col10a1 G T 10: 34,390,667 V16F unknown Het
Col3a1 G A 1: 45,321,574 V55I unknown Het
Ctns T C 11: 73,191,746 T53A probably benign Het
Cyp2b23 A T 7: 26,666,006 I468N probably damaging Het
Dcbld2 G A 16: 58,463,097 W565* probably null Het
Esco2 A T 14: 65,832,681 N16K probably benign Het
Fggy A G 4: 95,844,157 N462D possibly damaging Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Gm4846 T C 1: 166,494,672 T109A probably benign Het
H2-M11 G T 17: 36,548,134 V189L probably benign Het
Hmcn1 T A 1: 150,656,505 T3175S possibly damaging Het
Hook2 G A 8: 84,994,491 V184M probably benign Het
Hspa4l A T 3: 40,786,746 D730V probably damaging Het
Igkv4-68 C T 6: 69,305,129 M19I probably benign Het
Igsf9b C A 9: 27,317,364 T140N possibly damaging Het
Kcnj1 G A 9: 32,397,297 R339Q probably damaging Het
Lcn8 T G 2: 25,655,172 L118W probably damaging Het
Lin28a A G 4: 134,018,142 F47L possibly damaging Het
Loxl4 T C 19: 42,607,582 E144G probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrgprb1 C A 7: 48,448,147 E6* probably null Het
Mthfsd A C 8: 121,098,816 Y339D probably damaging Het
Mup11 A T 4: 60,659,778 F153L probably damaging Het
Pcdhac2 G A 18: 37,145,664 V566M probably benign Het
Plpp7 G T 2: 32,096,109 A100S probably benign Het
Prg4 T C 1: 150,456,023 T300A possibly damaging Het
Ptprd A G 4: 76,086,036 F161L probably benign Het
Pwp2 G A 10: 78,172,096 A875V possibly damaging Het
Rhd A G 4: 134,884,149 T207A possibly damaging Het
Sh2d3c C T 2: 32,753,138 R778C probably damaging Het
Slc34a3 A C 2: 25,229,277 V527G probably benign Het
Smad2 T C 18: 76,286,951 probably null Het
Spata21 C T 4: 141,112,006 Q611* probably null Het
Taf4b A G 18: 14,821,528 T554A probably benign Het
Tial1 T C 7: 128,442,470 T107A unknown Het
Ubxn6 C A 17: 56,073,195 R42L probably benign Het
Vmn2r90 A T 17: 17,726,880 N473I probably damaging Het
Ythdc1 T A 5: 86,821,274 Y351* probably null Het
Other mutations in Sp110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Sp110 APN 1 85577329 missense probably benign
IGL00510:Sp110 APN 1 85577329 missense probably benign
IGL00516:Sp110 APN 1 85577329 missense probably benign
IGL00990:Sp110 APN 1 85586281 missense possibly damaging 0.51
IGL03382:Sp110 APN 1 85577329 missense probably benign
FR4342:Sp110 UTSW 1 85587488 small insertion probably benign
FR4976:Sp110 UTSW 1 85587489 small insertion probably benign
IGL03147:Sp110 UTSW 1 85591567 frame shift probably null
PIT4131001:Sp110 UTSW 1 85586250 missense probably benign 0.05
PIT4131001:Sp110 UTSW 1 85586254 missense probably benign 0.01
PIT4142001:Sp110 UTSW 1 85586250 missense probably benign 0.05
PIT4142001:Sp110 UTSW 1 85586254 missense probably benign 0.01
R0472:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R0483:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R0551:Sp110 UTSW 1 85589100 splice site probably benign
R0638:Sp110 UTSW 1 85577329 missense probably benign
R0806:Sp110 UTSW 1 85586254 missense probably benign 0.01
R0806:Sp110 UTSW 1 85586281 missense possibly damaging 0.51
R1074:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R1079:Sp110 UTSW 1 85589104 splice site probably benign
R1228:Sp110 UTSW 1 85591760 missense probably benign 0.03
R1403:Sp110 UTSW 1 85579079 missense probably benign 0.00
R1406:Sp110 UTSW 1 85579079 missense probably benign 0.00
R1418:Sp110 UTSW 1 85594385 missense probably benign 0.08
R1718:Sp110 UTSW 1 85594385 missense probably benign 0.08
R1744:Sp110 UTSW 1 85594372 missense probably benign 0.26
R1747:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R1806:Sp110 UTSW 1 85596110 critical splice acceptor site probably null
R1957:Sp110 UTSW 1 85577329 missense probably benign
R2404:Sp110 UTSW 1 85577329 missense probably benign
R2964:Sp110 UTSW 1 85577329 missense probably benign
R3176:Sp110 UTSW 1 85577329 missense probably benign
R4190:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4398:Sp110 UTSW 1 85577329 missense probably benign
R4505:Sp110 UTSW 1 85589173 missense probably damaging 1.00
R4565:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4625:Sp110 UTSW 1 85577329 missense probably benign
R4922:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4986:Sp110 UTSW 1 85591760 missense probably benign 0.03
R5014:Sp110 UTSW 1 85577329 missense probably benign
R5080:Sp110 UTSW 1 85596055 nonsense probably null
R5087:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5254:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5335:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5353:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R5383:Sp110 UTSW 1 85591569 frame shift probably null
R5387:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5389:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5398:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5443:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R5447:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5729:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5752:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5754:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5799:Sp110 UTSW 1 85577329 missense probably benign
R6027:Sp110 UTSW 1 85577318 missense possibly damaging 0.83
R6171:Sp110 UTSW 1 85577329 missense probably benign
R6367:Sp110 UTSW 1 85594292 missense probably benign 0.00
R6771:Sp110 UTSW 1 85592279 intron probably null
R7097:Sp110 UTSW 1 85579685 missense possibly damaging 0.80
R7519:Sp110 UTSW 1 85579092 missense
R7520:Sp110 UTSW 1 85579092 missense
R7594:Sp110 UTSW 1 85579092 missense
R7596:Sp110 UTSW 1 85579092 missense
R7598:Sp110 UTSW 1 85579092 missense
R7600:Sp110 UTSW 1 85579092 missense
R7601:Sp110 UTSW 1 85579092 missense
R7602:Sp110 UTSW 1 85579092 missense
R7640:Sp110 UTSW 1 85579092 missense
R7641:Sp110 UTSW 1 85579092 missense
R7674:Sp110 UTSW 1 85579092 missense
R7691:Sp110 UTSW 1 85579092 missense
R7695:Sp110 UTSW 1 85579092 missense
X0035:Sp110 UTSW 1 85586254 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTTGGTTCAATATGTCTAAGTGC -3'
(R):5'- AGATCTAGGTGGAACCCTACG -3'

Sequencing Primer
(F):5'- GTTCAATATGTCTAAGTGCCTTCTTG -3'
(R):5'- CCTACGGGCTGGCAGAC -3'
Posted On2020-01-23