Incidental Mutation 'R8072:Slc34a3'
ID620272
Institutional Source Beutler Lab
Gene Symbol Slc34a3
Ensembl Gene ENSMUSG00000006469
Gene Namesolute carrier family 34 (sodium phosphate), member 3
SynonymsNPTIIc, Npt2c
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R8072 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location25228898-25234364 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 25229277 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 527 (V527G)
Ref Sequence ENSEMBL: ENSMUSP00000006638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006638] [ENSMUST00000043584]
Predicted Effect probably benign
Transcript: ENSMUST00000006638
AA Change: V527G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000006638
Gene: ENSMUSG00000006469
AA Change: V527G

DomainStartEndE-ValueType
Pfam:Na_Pi_cotrans 84 231 1.8e-25 PFAM
low complexity region 254 269 N/A INTRINSIC
Pfam:Na_Pi_cotrans 337 538 1.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043584
SMART Domains Protein: ENSMUSP00000042342
Gene: ENSMUSG00000036752

DomainStartEndE-ValueType
Tubulin 47 244 1.04e-67 SMART
Tubulin_C 246 383 3.89e-49 SMART
low complexity region 428 445 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of SLC34A transporter family of proteins, and is expressed primarily in the kidney. It is involved in transporting phosphate into cells via sodium cotransport in the renal brush border membrane, and contributes to the maintenance of inorganic phosphate concentration in the kidney. Mutations in this gene are associated with hereditary hypophosphatemic rickets with hypercalciuria. Alternatively spliced transcript variants varying in the 5' UTR have been found for this gene.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypercalciuria, hypercalcemia and increased plasma 1,25(OH)2D3 levels but do not develop hypophosphatemia, renal calcification, rickets, or osteomalacia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,294,574 S2146P probably benign Het
Acad9 G A 3: 36,075,255 V160I probably benign Het
Ace T C 11: 105,972,959 V411A probably damaging Het
Ankrd66 T C 17: 43,543,635 E2G possibly damaging Het
Apol6 A T 15: 77,051,103 T191S probably benign Het
Arhgef17 T A 7: 100,881,797 T352S probably benign Het
Atad2 C T 15: 58,099,978 R1081Q possibly damaging Het
Atg3 G T 16: 45,187,685 V297F probably damaging Het
Atp9b A C 18: 80,765,061 S663A Het
Col10a1 G T 10: 34,390,667 V16F unknown Het
Col3a1 G A 1: 45,321,574 V55I unknown Het
Ctns T C 11: 73,191,746 T53A probably benign Het
Cyp2b23 A T 7: 26,666,006 I468N probably damaging Het
Dcbld2 G A 16: 58,463,097 W565* probably null Het
Esco2 A T 14: 65,832,681 N16K probably benign Het
Fggy A G 4: 95,844,157 N462D possibly damaging Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Gm4846 T C 1: 166,494,672 T109A probably benign Het
H2-M11 G T 17: 36,548,134 V189L probably benign Het
Hmcn1 T A 1: 150,656,505 T3175S possibly damaging Het
Hook2 G A 8: 84,994,491 V184M probably benign Het
Hspa4l A T 3: 40,786,746 D730V probably damaging Het
Igkv4-68 C T 6: 69,305,129 M19I probably benign Het
Igsf9b C A 9: 27,317,364 T140N possibly damaging Het
Kcnj1 G A 9: 32,397,297 R339Q probably damaging Het
Lcn8 T G 2: 25,655,172 L118W probably damaging Het
Lin28a A G 4: 134,018,142 F47L possibly damaging Het
Loxl4 T C 19: 42,607,582 E144G probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrgprb1 C A 7: 48,448,147 E6* probably null Het
Mthfsd A C 8: 121,098,816 Y339D probably damaging Het
Mup11 A T 4: 60,659,778 F153L probably damaging Het
Pcdhac2 G A 18: 37,145,664 V566M probably benign Het
Plpp7 G T 2: 32,096,109 A100S probably benign Het
Prg4 T C 1: 150,456,023 T300A possibly damaging Het
Ptprd A G 4: 76,086,036 F161L probably benign Het
Pwp2 G A 10: 78,172,096 A875V possibly damaging Het
Rhd A G 4: 134,884,149 T207A possibly damaging Het
Sh2d3c C T 2: 32,753,138 R778C probably damaging Het
Smad2 T C 18: 76,286,951 probably null Het
Sp110 GTACT GTACTACT 1: 85,587,486 probably benign Het
Spata21 C T 4: 141,112,006 Q611* probably null Het
Taf4b A G 18: 14,821,528 T554A probably benign Het
Tial1 T C 7: 128,442,470 T107A unknown Het
Ubxn6 C A 17: 56,073,195 R42L probably benign Het
Vmn2r90 A T 17: 17,726,880 N473I probably damaging Het
Ythdc1 T A 5: 86,821,274 Y351* probably null Het
Other mutations in Slc34a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02422:Slc34a3 APN 2 25232263 missense probably benign 0.01
IGL02885:Slc34a3 APN 2 25231057 missense probably damaging 1.00
IGL03131:Slc34a3 APN 2 25231234 missense probably benign
IGL03166:Slc34a3 APN 2 25232174 missense probably damaging 0.99
IGL03278:Slc34a3 APN 2 25232047 missense probably benign 0.01
PIT4544001:Slc34a3 UTSW 2 25230595 missense probably benign 0.27
R0415:Slc34a3 UTSW 2 25229110 missense probably benign
R0558:Slc34a3 UTSW 2 25233065 unclassified probably benign
R0883:Slc34a3 UTSW 2 25231233 missense probably benign
R2107:Slc34a3 UTSW 2 25230987 missense probably damaging 0.99
R2329:Slc34a3 UTSW 2 25229410 missense possibly damaging 0.95
R3108:Slc34a3 UTSW 2 25229245 missense probably benign
R4637:Slc34a3 UTSW 2 25229461 missense possibly damaging 0.92
R5008:Slc34a3 UTSW 2 25230842 missense possibly damaging 0.62
R5341:Slc34a3 UTSW 2 25230659 missense probably benign 0.00
R5623:Slc34a3 UTSW 2 25233300 splice site probably null
R6602:Slc34a3 UTSW 2 25229209 missense probably damaging 0.99
R7512:Slc34a3 UTSW 2 25232241 splice site probably null
R7784:Slc34a3 UTSW 2 25232225 missense probably damaging 1.00
R8730:Slc34a3 UTSW 2 25232045 missense possibly damaging 0.80
R8762:Slc34a3 UTSW 2 25230991 missense probably benign 0.03
R8880:Slc34a3 UTSW 2 25229255 missense probably benign 0.03
Z1176:Slc34a3 UTSW 2 25229398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCACTTTGCTGGTCATAG -3'
(R):5'- CTTCAACCTGGCTGGCATAC -3'

Sequencing Primer
(F):5'- CCACTTTGCTGGTCATAGGAGAG -3'
(R):5'- CTGGCATACTGCTGTGGTACC -3'
Posted On2020-01-23