Incidental Mutation 'R8072:Sh2d3c'
ID620275
Institutional Source Beutler Lab
Gene Symbol Sh2d3c
Ensembl Gene ENSMUSG00000059013
Gene NameSH2 domain containing 3C
SynonymsChat, Cas/HEF1-associated signal transducer, Nsp3, Shep1, SH2-containing Eph receptor-binding protein 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8072 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location32721055-32755512 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32753138 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 778 (R778C)
Ref Sequence ENSEMBL: ENSMUSP00000073866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009707] [ENSMUST00000074248] [ENSMUST00000091059] [ENSMUST00000113242] [ENSMUST00000156617] [ENSMUST00000175763] [ENSMUST00000177382]
Predicted Effect probably benign
Transcript: ENSMUST00000009707
SMART Domains Protein: ENSMUSP00000009707
Gene: ENSMUSG00000009563

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Torsin 35 160 1.2e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000074248
AA Change: R778C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073866
Gene: ENSMUSG00000059013
AA Change: R778C

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
low complexity region 22 43 N/A INTRINSIC
low complexity region 86 98 N/A INTRINSIC
low complexity region 117 132 N/A INTRINSIC
low complexity region 190 207 N/A INTRINSIC
SH2 213 301 7.8e-21 SMART
low complexity region 333 348 N/A INTRINSIC
low complexity region 400 415 N/A INTRINSIC
low complexity region 422 436 N/A INTRINSIC
low complexity region 474 487 N/A INTRINSIC
RasGEF 576 849 8.18e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091059
SMART Domains Protein: ENSMUSP00000088585
Gene: ENSMUSG00000039021

DomainStartEndE-ValueType
TPR 75 108 2.26e-3 SMART
TPR 109 142 4.09e-1 SMART
TPR 150 183 8.3e-2 SMART
TPR 218 251 4.44e1 SMART
TPR 265 298 3.69e1 SMART
TPR 299 332 1.08e1 SMART
Blast:TPR 345 378 2e-10 BLAST
TPR 379 412 1.02e-1 SMART
TPR 420 453 7.27e0 SMART
Blast:TPR 454 487 2e-12 BLAST
low complexity region 631 644 N/A INTRINSIC
low complexity region 666 679 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113242
AA Change: R626C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108868
Gene: ENSMUSG00000059013
AA Change: R626C

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
SH2 61 149 7.8e-21 SMART
low complexity region 181 196 N/A INTRINSIC
low complexity region 248 263 N/A INTRINSIC
low complexity region 270 284 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
RasGEF 424 697 8.18e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140999
Predicted Effect probably benign
Transcript: ENSMUST00000156617
SMART Domains Protein: ENSMUSP00000122251
Gene: ENSMUSG00000009563

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175763
SMART Domains Protein: ENSMUSP00000135701
Gene: ENSMUSG00000009563

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177382
SMART Domains Protein: ENSMUSP00000134968
Gene: ENSMUSG00000009563

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Torsin 35 101 1.4e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein and member of a cytoplasmic protein family involved in cell migration. The encoded protein contains a putative Src homology 2 (SH2) domain and guanine nucleotide exchange factor-like domain which allows this signaling protein to form a complex with scaffolding protein Crk-associated substrate. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality with absence of gastric milk. Surviving mice exhibit abnormal olfactory bulb innervation, fewer gonadotrophin positive cells in the hypothalamus, and decreased testes size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,294,574 S2146P probably benign Het
Acad9 G A 3: 36,075,255 V160I probably benign Het
Ace T C 11: 105,972,959 V411A probably damaging Het
Ankrd66 T C 17: 43,543,635 E2G possibly damaging Het
Apol6 A T 15: 77,051,103 T191S probably benign Het
Arhgef17 T A 7: 100,881,797 T352S probably benign Het
Atad2 C T 15: 58,099,978 R1081Q possibly damaging Het
Atg3 G T 16: 45,187,685 V297F probably damaging Het
Atp9b A C 18: 80,765,061 S663A Het
Col10a1 G T 10: 34,390,667 V16F unknown Het
Col3a1 G A 1: 45,321,574 V55I unknown Het
Ctns T C 11: 73,191,746 T53A probably benign Het
Cyp2b23 A T 7: 26,666,006 I468N probably damaging Het
Dcbld2 G A 16: 58,463,097 W565* probably null Het
Esco2 A T 14: 65,832,681 N16K probably benign Het
Fggy A G 4: 95,844,157 N462D possibly damaging Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Gm4846 T C 1: 166,494,672 T109A probably benign Het
H2-M11 G T 17: 36,548,134 V189L probably benign Het
Hmcn1 T A 1: 150,656,505 T3175S possibly damaging Het
Hook2 G A 8: 84,994,491 V184M probably benign Het
Hspa4l A T 3: 40,786,746 D730V probably damaging Het
Igkv4-68 C T 6: 69,305,129 M19I probably benign Het
Igsf9b C A 9: 27,317,364 T140N possibly damaging Het
Kcnj1 G A 9: 32,397,297 R339Q probably damaging Het
Lcn8 T G 2: 25,655,172 L118W probably damaging Het
Lin28a A G 4: 134,018,142 F47L possibly damaging Het
Loxl4 T C 19: 42,607,582 E144G probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrgprb1 C A 7: 48,448,147 E6* probably null Het
Mthfsd A C 8: 121,098,816 Y339D probably damaging Het
Mup11 A T 4: 60,659,778 F153L probably damaging Het
Pcdhac2 G A 18: 37,145,664 V566M probably benign Het
Plpp7 G T 2: 32,096,109 A100S probably benign Het
Prg4 T C 1: 150,456,023 T300A possibly damaging Het
Ptprd A G 4: 76,086,036 F161L probably benign Het
Pwp2 G A 10: 78,172,096 A875V possibly damaging Het
Rhd A G 4: 134,884,149 T207A possibly damaging Het
Slc34a3 A C 2: 25,229,277 V527G probably benign Het
Smad2 T C 18: 76,286,951 probably null Het
Sp110 GTACT GTACTACT 1: 85,587,486 probably benign Het
Spata21 C T 4: 141,112,006 Q611* probably null Het
Taf4b A G 18: 14,821,528 T554A probably benign Het
Tial1 T C 7: 128,442,470 T107A unknown Het
Ubxn6 C A 17: 56,073,195 R42L probably benign Het
Vmn2r90 A T 17: 17,726,880 N473I probably damaging Het
Ythdc1 T A 5: 86,821,274 Y351* probably null Het
Other mutations in Sh2d3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Sh2d3c APN 2 32725084 missense probably benign 0.00
IGL02326:Sh2d3c APN 2 32749151 critical splice acceptor site probably null
IGL03325:Sh2d3c APN 2 32725258 missense probably benign 0.00
R0008:Sh2d3c UTSW 2 32753021 missense probably damaging 1.00
R0564:Sh2d3c UTSW 2 32753052 missense probably damaging 0.99
R0619:Sh2d3c UTSW 2 32753025 missense probably damaging 1.00
R1138:Sh2d3c UTSW 2 32749405 missense probably benign 0.00
R1984:Sh2d3c UTSW 2 32749244 nonsense probably null
R3808:Sh2d3c UTSW 2 32746096 missense probably damaging 1.00
R4399:Sh2d3c UTSW 2 32746160 missense probably damaging 0.97
R4556:Sh2d3c UTSW 2 32753009 missense possibly damaging 0.81
R4840:Sh2d3c UTSW 2 32721160 start codon destroyed probably null 0.02
R5027:Sh2d3c UTSW 2 32744802 missense possibly damaging 0.95
R5367:Sh2d3c UTSW 2 32745902 missense probably damaging 1.00
R6754:Sh2d3c UTSW 2 32754530 missense probably damaging 1.00
R6916:Sh2d3c UTSW 2 32752653 nonsense probably null
R7029:Sh2d3c UTSW 2 32754569 makesense probably null
R7047:Sh2d3c UTSW 2 32721160 start codon destroyed probably null 0.02
R7636:Sh2d3c UTSW 2 32725011 missense probably benign 0.17
R7893:Sh2d3c UTSW 2 32749376 nonsense probably null
R8115:Sh2d3c UTSW 2 32725264 missense probably benign 0.12
R8447:Sh2d3c UTSW 2 32752659 missense probably damaging 1.00
R8553:Sh2d3c UTSW 2 32745913 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGGTCTAAGAGCCTGCC -3'
(R):5'- ACAACTGCCTATGAGTGACAAGAC -3'

Sequencing Primer
(F):5'- CGCCCCTCTCCACAGAAGG -3'
(R):5'- CTGCCTATGAGTGACAAGACAGATG -3'
Posted On2020-01-23