Incidental Mutation 'R8072:Hspa4l'
ID620277
Institutional Source Beutler Lab
Gene Symbol Hspa4l
Ensembl Gene ENSMUSG00000025757
Gene Nameheat shock protein 4 like
Synonyms94kDa, Osp94, APG-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R8072 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location40744495-40796103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40786746 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 730 (D730V)
Ref Sequence ENSEMBL: ENSMUSP00000145468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108086] [ENSMUST00000204702]
Predicted Effect probably damaging
Transcript: ENSMUST00000108086
AA Change: D709V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103721
Gene: ENSMUSG00000025757
AA Change: D709V

DomainStartEndE-ValueType
Pfam:HSP70 11 673 2.1e-171 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204702
AA Change: D730V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145468
Gene: ENSMUSG00000025757
AA Change: D730V

DomainStartEndE-ValueType
Pfam:HSP70 3 694 1.3e-192 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is heat shock inducible and may act as a chaperone. The encoded protein can protect the heat-shocked cell against the harmful effects of aggregated proteins. This gene is highly expressed in leukemia cells and may be a good target for therapeutic intervention. Several transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display increased incidence of male infertility, due to reduced number of mature sperm and reduced sperm motility, and hydronephrosis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,294,574 S2146P probably benign Het
Acad9 G A 3: 36,075,255 V160I probably benign Het
Ace T C 11: 105,972,959 V411A probably damaging Het
Ankrd66 T C 17: 43,543,635 E2G possibly damaging Het
Apol6 A T 15: 77,051,103 T191S probably benign Het
Arhgef17 T A 7: 100,881,797 T352S probably benign Het
Atad2 C T 15: 58,099,978 R1081Q possibly damaging Het
Atg3 G T 16: 45,187,685 V297F probably damaging Het
Atp9b A C 18: 80,765,061 S663A Het
Col10a1 G T 10: 34,390,667 V16F unknown Het
Col3a1 G A 1: 45,321,574 V55I unknown Het
Ctns T C 11: 73,191,746 T53A probably benign Het
Cyp2b23 A T 7: 26,666,006 I468N probably damaging Het
Dcbld2 G A 16: 58,463,097 W565* probably null Het
Esco2 A T 14: 65,832,681 N16K probably benign Het
Fggy A G 4: 95,844,157 N462D possibly damaging Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Gm4846 T C 1: 166,494,672 T109A probably benign Het
H2-M11 G T 17: 36,548,134 V189L probably benign Het
Hmcn1 T A 1: 150,656,505 T3175S possibly damaging Het
Hook2 G A 8: 84,994,491 V184M probably benign Het
Igkv4-68 C T 6: 69,305,129 M19I probably benign Het
Igsf9b C A 9: 27,317,364 T140N possibly damaging Het
Kcnj1 G A 9: 32,397,297 R339Q probably damaging Het
Lcn8 T G 2: 25,655,172 L118W probably damaging Het
Lin28a A G 4: 134,018,142 F47L possibly damaging Het
Loxl4 T C 19: 42,607,582 E144G probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrgprb1 C A 7: 48,448,147 E6* probably null Het
Mthfsd A C 8: 121,098,816 Y339D probably damaging Het
Mup11 A T 4: 60,659,778 F153L probably damaging Het
Pcdhac2 G A 18: 37,145,664 V566M probably benign Het
Plpp7 G T 2: 32,096,109 A100S probably benign Het
Prg4 T C 1: 150,456,023 T300A possibly damaging Het
Ptprd A G 4: 76,086,036 F161L probably benign Het
Pwp2 G A 10: 78,172,096 A875V possibly damaging Het
Rhd A G 4: 134,884,149 T207A possibly damaging Het
Sh2d3c C T 2: 32,753,138 R778C probably damaging Het
Slc34a3 A C 2: 25,229,277 V527G probably benign Het
Smad2 T C 18: 76,286,951 probably null Het
Sp110 GTACT GTACTACT 1: 85,587,486 probably benign Het
Spata21 C T 4: 141,112,006 Q611* probably null Het
Taf4b A G 18: 14,821,528 T554A probably benign Het
Tial1 T C 7: 128,442,470 T107A unknown Het
Ubxn6 C A 17: 56,073,195 R42L probably benign Het
Vmn2r90 A T 17: 17,726,880 N473I probably damaging Het
Ythdc1 T A 5: 86,821,274 Y351* probably null Het
Other mutations in Hspa4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02466:Hspa4l APN 3 40753225 nonsense probably null
IGL02605:Hspa4l APN 3 40781623 missense probably benign 0.20
IGL02719:Hspa4l APN 3 40772658 missense possibly damaging 0.60
R0281:Hspa4l UTSW 3 40785408 splice site probably benign
R0398:Hspa4l UTSW 3 40756997 splice site probably benign
R0487:Hspa4l UTSW 3 40784326 missense possibly damaging 0.87
R0610:Hspa4l UTSW 3 40779400 missense probably benign 0.01
R0760:Hspa4l UTSW 3 40784723 nonsense probably null
R1491:Hspa4l UTSW 3 40786794 missense probably benign 0.00
R1720:Hspa4l UTSW 3 40781617 nonsense probably null
R1984:Hspa4l UTSW 3 40760401 missense probably damaging 1.00
R1986:Hspa4l UTSW 3 40760401 missense probably damaging 1.00
R2100:Hspa4l UTSW 3 40772658 missense possibly damaging 0.60
R3706:Hspa4l UTSW 3 40781693 missense possibly damaging 0.55
R3708:Hspa4l UTSW 3 40781693 missense possibly damaging 0.55
R3856:Hspa4l UTSW 3 40785389 missense probably benign 0.29
R3874:Hspa4l UTSW 3 40772642 missense probably damaging 1.00
R3890:Hspa4l UTSW 3 40781594 missense possibly damaging 0.90
R4256:Hspa4l UTSW 3 40746003 missense probably benign 0.03
R4364:Hspa4l UTSW 3 40766809 splice site probably null
R4365:Hspa4l UTSW 3 40766809 splice site probably null
R4366:Hspa4l UTSW 3 40766809 splice site probably null
R4493:Hspa4l UTSW 3 40768002 missense possibly damaging 0.77
R4494:Hspa4l UTSW 3 40753204 missense possibly damaging 0.86
R4954:Hspa4l UTSW 3 40785400 critical splice donor site probably null
R4994:Hspa4l UTSW 3 40745649 utr 5 prime probably benign
R5114:Hspa4l UTSW 3 40745765 missense possibly damaging 0.60
R5133:Hspa4l UTSW 3 40786747 missense possibly damaging 0.94
R5202:Hspa4l UTSW 3 40781569 missense probably benign 0.17
R5440:Hspa4l UTSW 3 40781576 missense probably damaging 1.00
R5635:Hspa4l UTSW 3 40745745 missense probably damaging 1.00
R5997:Hspa4l UTSW 3 40767979 missense probably damaging 0.99
R6012:Hspa4l UTSW 3 40781599 missense probably benign 0.09
R6515:Hspa4l UTSW 3 40781582 missense possibly damaging 0.82
R6589:Hspa4l UTSW 3 40757055 missense probably damaging 0.99
R7091:Hspa4l UTSW 3 40781592 missense probably benign 0.00
R7601:Hspa4l UTSW 3 40784356 critical splice donor site probably null
Z1088:Hspa4l UTSW 3 40766993 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGTCCTTTGGAAATCTGCACTG -3'
(R):5'- GCCATTAAGCACGGTTGAAAAG -3'

Sequencing Primer
(F):5'- CCTTTGGAAATCTGCACTGATTTTAC -3'
(R):5'- TGAAAAGGGAATGGAGTTTCTTACC -3'
Posted On2020-01-23