Incidental Mutation 'R8072:Lin28a'
ID620281
Institutional Source Beutler Lab
Gene Symbol Lin28a
Ensembl Gene ENSMUSG00000050966
Gene Namelin-28 homolog A (C. elegans)
SynonymsLin-28, Tex17, Lin28a, Lin28
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8072 (G1)
Quality Score168.009
Status Not validated
Chromosome4
Chromosomal Location134003330-134018841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134018142 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 47 (F47L)
Ref Sequence ENSEMBL: ENSMUSP00000050488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051674] [ENSMUST00000176897]
PDB Structure Mouse Lin28A in complex with let-7d microRNA pre-element [X-RAY DIFFRACTION]
Mouse Lin28A in complex with let-7f-1 microRNA pre-element [X-RAY DIFFRACTION]
Mouse Lin28A in complex with let-7g microRNA pre-element [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051674
AA Change: F47L

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050488
Gene: ENSMUSG00000050966
AA Change: F47L

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
CSP 41 112 5.63e-14 SMART
ZnF_C2HC 138 154 1.91e-2 SMART
ZnF_C2HC 160 176 4.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176897
SMART Domains Protein: ENSMUSP00000135736
Gene: ENSMUSG00000050966

DomainStartEndE-ValueType
Pfam:CSD 1 62 5.8e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a LIN-28 family RNA-binding protein that acts as a posttranscriptional regulator of genes involved in developmental timing and self-renewal in embryonic stem cells. The encoded protein functions through direct interaction with target mRNAs and by disrupting the maturation of certain miRNAs involved in embryonic development. This protein prevents the terminal processing of the LET7 family of microRNAs which are major regulators of cellular growth and differentiation. Aberrant expression of this gene is associated with cancer progression in multiple tissues. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased birth weight and postnatal lethality. In another report, mice homozygous for the same or an identical allele exhibit reduced premordial germ cells and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,294,574 S2146P probably benign Het
Acad9 G A 3: 36,075,255 V160I probably benign Het
Ace T C 11: 105,972,959 V411A probably damaging Het
Ankrd66 T C 17: 43,543,635 E2G possibly damaging Het
Apol6 A T 15: 77,051,103 T191S probably benign Het
Arhgef17 T A 7: 100,881,797 T352S probably benign Het
Atad2 C T 15: 58,099,978 R1081Q possibly damaging Het
Atg3 G T 16: 45,187,685 V297F probably damaging Het
Atp9b A C 18: 80,765,061 S663A Het
Col10a1 G T 10: 34,390,667 V16F unknown Het
Col3a1 G A 1: 45,321,574 V55I unknown Het
Ctns T C 11: 73,191,746 T53A probably benign Het
Cyp2b23 A T 7: 26,666,006 I468N probably damaging Het
Dcbld2 G A 16: 58,463,097 W565* probably null Het
Esco2 A T 14: 65,832,681 N16K probably benign Het
Fggy A G 4: 95,844,157 N462D possibly damaging Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Gm4846 T C 1: 166,494,672 T109A probably benign Het
H2-M11 G T 17: 36,548,134 V189L probably benign Het
Hmcn1 T A 1: 150,656,505 T3175S possibly damaging Het
Hook2 G A 8: 84,994,491 V184M probably benign Het
Hspa4l A T 3: 40,786,746 D730V probably damaging Het
Igkv4-68 C T 6: 69,305,129 M19I probably benign Het
Igsf9b C A 9: 27,317,364 T140N possibly damaging Het
Kcnj1 G A 9: 32,397,297 R339Q probably damaging Het
Lcn8 T G 2: 25,655,172 L118W probably damaging Het
Loxl4 T C 19: 42,607,582 E144G probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrgprb1 C A 7: 48,448,147 E6* probably null Het
Mthfsd A C 8: 121,098,816 Y339D probably damaging Het
Mup11 A T 4: 60,659,778 F153L probably damaging Het
Pcdhac2 G A 18: 37,145,664 V566M probably benign Het
Plpp7 G T 2: 32,096,109 A100S probably benign Het
Prg4 T C 1: 150,456,023 T300A possibly damaging Het
Ptprd A G 4: 76,086,036 F161L probably benign Het
Pwp2 G A 10: 78,172,096 A875V possibly damaging Het
Rhd A G 4: 134,884,149 T207A possibly damaging Het
Sh2d3c C T 2: 32,753,138 R778C probably damaging Het
Slc34a3 A C 2: 25,229,277 V527G probably benign Het
Smad2 T C 18: 76,286,951 probably null Het
Sp110 GTACT GTACTACT 1: 85,587,486 probably benign Het
Spata21 C T 4: 141,112,006 Q611* probably null Het
Taf4b A G 18: 14,821,528 T554A probably benign Het
Tial1 T C 7: 128,442,470 T107A unknown Het
Ubxn6 C A 17: 56,073,195 R42L probably benign Het
Vmn2r90 A T 17: 17,726,880 N473I probably damaging Het
Ythdc1 T A 5: 86,821,274 Y351* probably null Het
Other mutations in Lin28a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Lin28a APN 4 134008056 missense probably damaging 1.00
IGL01515:Lin28a APN 4 134018709 critical splice donor site probably null
IGL01725:Lin28a APN 4 134007930 nonsense probably null
R0659:Lin28a UTSW 4 134008099 splice site probably benign
R0730:Lin28a UTSW 4 134008008 missense probably damaging 1.00
R2129:Lin28a UTSW 4 134018154 missense probably benign 0.00
R3196:Lin28a UTSW 4 134007924 missense possibly damaging 0.80
R4998:Lin28a UTSW 4 134018717 missense possibly damaging 0.73
R5734:Lin28a UTSW 4 134007973 nonsense probably null
R6540:Lin28a UTSW 4 134018061 missense possibly damaging 0.85
R7012:Lin28a UTSW 4 134018729 missense probably damaging 1.00
R7226:Lin28a UTSW 4 134006308 missense probably damaging 1.00
R7972:Lin28a UTSW 4 134006263 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TATCTCCTCCAATCCGACAGG -3'
(R):5'- CTTCTTACCAGCTGCTTGGTAG -3'

Sequencing Primer
(F):5'- ACAGGAGGGGCCACCAG -3'
(R):5'- GGCTGACCACCGAGATCTC -3'
Posted On2020-01-23