Incidental Mutation 'R8072:Mrgprb1'
ID620287
Institutional Source Beutler Lab
Gene Symbol Mrgprb1
Ensembl Gene ENSMUSG00000070547
Gene NameMAS-related GPR, member B1
SynonymsMrgB1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R8072 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location48444113-48456342 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 48448147 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 6 (E6*)
Ref Sequence ENSEMBL: ENSMUSP00000091946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094384] [ENSMUST00000188095] [ENSMUST00000188918]
Predicted Effect probably null
Transcript: ENSMUST00000094384
AA Change: E6*
SMART Domains Protein: ENSMUSP00000091946
Gene: ENSMUSG00000070547
AA Change: E6*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 50 227 5.5e-11 PFAM
Pfam:7tm_1 59 290 4.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188095
Predicted Effect probably null
Transcript: ENSMUST00000188918
AA Change: E6*
SMART Domains Protein: ENSMUSP00000140432
Gene: ENSMUSG00000070547
AA Change: E6*

DomainStartEndE-ValueType
SCOP:d1l9ha_ 23 84 3e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,294,574 S2146P probably benign Het
Acad9 G A 3: 36,075,255 V160I probably benign Het
Ace T C 11: 105,972,959 V411A probably damaging Het
Ankrd66 T C 17: 43,543,635 E2G possibly damaging Het
Apol6 A T 15: 77,051,103 T191S probably benign Het
Arhgef17 T A 7: 100,881,797 T352S probably benign Het
Atad2 C T 15: 58,099,978 R1081Q possibly damaging Het
Atg3 G T 16: 45,187,685 V297F probably damaging Het
Atp9b A C 18: 80,765,061 S663A Het
Col10a1 G T 10: 34,390,667 V16F unknown Het
Col3a1 G A 1: 45,321,574 V55I unknown Het
Ctns T C 11: 73,191,746 T53A probably benign Het
Cyp2b23 A T 7: 26,666,006 I468N probably damaging Het
Dcbld2 G A 16: 58,463,097 W565* probably null Het
Esco2 A T 14: 65,832,681 N16K probably benign Het
Fggy A G 4: 95,844,157 N462D possibly damaging Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Gm4846 T C 1: 166,494,672 T109A probably benign Het
H2-M11 G T 17: 36,548,134 V189L probably benign Het
Hmcn1 T A 1: 150,656,505 T3175S possibly damaging Het
Hook2 G A 8: 84,994,491 V184M probably benign Het
Hspa4l A T 3: 40,786,746 D730V probably damaging Het
Igkv4-68 C T 6: 69,305,129 M19I probably benign Het
Igsf9b C A 9: 27,317,364 T140N possibly damaging Het
Kcnj1 G A 9: 32,397,297 R339Q probably damaging Het
Lcn8 T G 2: 25,655,172 L118W probably damaging Het
Lin28a A G 4: 134,018,142 F47L possibly damaging Het
Loxl4 T C 19: 42,607,582 E144G probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mthfsd A C 8: 121,098,816 Y339D probably damaging Het
Mup11 A T 4: 60,659,778 F153L probably damaging Het
Pcdhac2 G A 18: 37,145,664 V566M probably benign Het
Plpp7 G T 2: 32,096,109 A100S probably benign Het
Prg4 T C 1: 150,456,023 T300A possibly damaging Het
Ptprd A G 4: 76,086,036 F161L probably benign Het
Pwp2 G A 10: 78,172,096 A875V possibly damaging Het
Rhd A G 4: 134,884,149 T207A possibly damaging Het
Sh2d3c C T 2: 32,753,138 R778C probably damaging Het
Slc34a3 A C 2: 25,229,277 V527G probably benign Het
Smad2 T C 18: 76,286,951 probably null Het
Sp110 GTACT GTACTACT 1: 85,587,486 probably benign Het
Spata21 C T 4: 141,112,006 Q611* probably null Het
Taf4b A G 18: 14,821,528 T554A probably benign Het
Tial1 T C 7: 128,442,470 T107A unknown Het
Ubxn6 C A 17: 56,073,195 R42L probably benign Het
Vmn2r90 A T 17: 17,726,880 N473I probably damaging Het
Ythdc1 T A 5: 86,821,274 Y351* probably null Het
Other mutations in Mrgprb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Mrgprb1 APN 7 48447543 missense probably damaging 0.99
IGL01141:Mrgprb1 APN 7 48448027 missense probably benign 0.36
IGL01393:Mrgprb1 APN 7 48448006 missense possibly damaging 0.48
IGL02430:Mrgprb1 APN 7 48447661 missense possibly damaging 0.95
IGL02485:Mrgprb1 APN 7 48447717 missense possibly damaging 0.88
R0026:Mrgprb1 UTSW 7 48447204 missense possibly damaging 0.66
R0051:Mrgprb1 UTSW 7 48447214 missense probably benign 0.01
R0789:Mrgprb1 UTSW 7 48456184 splice site probably benign
R1223:Mrgprb1 UTSW 7 48447687 missense possibly damaging 0.61
R1327:Mrgprb1 UTSW 7 48447429 missense possibly damaging 0.87
R1456:Mrgprb1 UTSW 7 48448029 missense probably damaging 0.98
R1561:Mrgprb1 UTSW 7 48447125 splice site probably null
R1567:Mrgprb1 UTSW 7 48447453 missense probably damaging 0.97
R2030:Mrgprb1 UTSW 7 48447328 missense possibly damaging 0.83
R2165:Mrgprb1 UTSW 7 48447322 missense probably benign 0.00
R2885:Mrgprb1 UTSW 7 48447721 missense probably damaging 1.00
R3108:Mrgprb1 UTSW 7 48447328 missense possibly damaging 0.93
R3919:Mrgprb1 UTSW 7 48448081 missense probably benign 0.03
R4021:Mrgprb1 UTSW 7 48447123 missense possibly damaging 0.95
R4613:Mrgprb1 UTSW 7 48447708 missense possibly damaging 0.91
R4809:Mrgprb1 UTSW 7 48447991 missense possibly damaging 0.89
R5249:Mrgprb1 UTSW 7 48447477 missense possibly damaging 0.91
R5425:Mrgprb1 UTSW 7 48447971 missense possibly damaging 0.81
R5555:Mrgprb1 UTSW 7 48447775 missense probably benign 0.06
R5595:Mrgprb1 UTSW 7 48447684 missense probably damaging 0.99
R5982:Mrgprb1 UTSW 7 48447820 missense probably benign 0.01
R6746:Mrgprb1 UTSW 7 48447897 missense possibly damaging 0.82
R7066:Mrgprb1 UTSW 7 48447676 missense probably benign 0.27
R7141:Mrgprb1 UTSW 7 48447687 missense possibly damaging 0.61
R7633:Mrgprb1 UTSW 7 48447583 missense probably benign 0.01
R8080:Mrgprb1 UTSW 7 48446910 splice site probably null
R8112:Mrgprb1 UTSW 7 48447934 missense probably damaging 0.97
R8493:Mrgprb1 UTSW 7 48447573 missense probably damaging 0.99
R8817:Mrgprb1 UTSW 7 48447322 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACCATAACACTGTGGCATTTCC -3'
(R):5'- TTTATTTTGCATGGCCAGCAC -3'

Sequencing Primer
(F):5'- TGGCATTTCCAACCAGCC -3'
(R):5'- GGGTGTTCCTGAGAATTC -3'
Posted On2020-01-23